\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716554113:

Variant ID: vg0716554113 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16554113
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACATGCCACCACGACATACCGGAAAGAGGCCGTGACAGGACCCTTCACATAACCCCCTCTAGCCAAGCACACCACACCTCAGGTTTCACCCCCGTCCC[T/C]
AGCGGGCAACGGACAGTCCCCTCTCGTGCCTCGGTGAATCCGAAAGCGACAGAGGCTGTCGCAGGGCCCGCCCCGCACCATCACGCCCACCCTTGCCTGG

Reverse complement sequence

CCAGGCAAGGGTGGGCGTGATGGTGCGGGGCGGGCCCTGCGACAGCCTCTGTCGCTTTCGGATTCACCGAGGCACGAGAGGGGACTGTCCGTTGCCCGCT[A/G]
GGGACGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGCTAGAGGGGGTTATGTGAAGGGTCCTGTCACGGCCTCTTTCCGGTATGTCGTGGTGGCATGTCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.70% 0.70% 3.60% 44.99% NA
All Indica  2759 26.10% 1.10% 4.97% 67.78% NA
All Japonica  1512 99.00% 0.20% 0.20% 0.60% NA
Aus  269 15.20% 0.00% 9.67% 75.09% NA
Indica I  595 45.50% 0.00% 3.03% 51.43% NA
Indica II  465 8.00% 0.00% 5.59% 86.45% NA
Indica III  913 19.80% 0.10% 6.35% 73.71% NA
Indica Intermediate  786 29.50% 3.80% 4.45% 62.21% NA
Temperate Japonica  767 98.70% 0.40% 0.26% 0.65% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 0.00% 0.41% 1.24% NA
VI/Aromatic  96 84.40% 0.00% 0.00% 15.62% NA
Intermediate  90 62.20% 0.00% 4.44% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716554113 T -> DEL N N silent_mutation Average:33.476; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N
vg0716554113 T -> C LOC_Os07g28350.1 downstream_gene_variant ; 4134.0bp to feature; MODIFIER silent_mutation Average:33.476; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N
vg0716554113 T -> C LOC_Os07g28360.1 intron_variant ; MODIFIER silent_mutation Average:33.476; most accessible tissue: Zhenshan97 flag leaf, score: 81.985 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0716554113 T C -0.01 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716554113 NA 3.79E-07 mr1705 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716554113 5.26E-06 NA mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716554113 2.57E-07 2.12E-10 mr1705_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251