Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716538042:

Variant ID: vg0716538042 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16538042
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:

GGCGGTGGAGCAATGGTGCTTCAGTGGTAGATCGACAGGTGATGGACGGCGTCATTCTCCTCTTGAGGGTGTTGTCGTGCCGTCTCACCACCTCAAGTGT[A/G]
GCTACCGGGCGAAAGCCCAGTTTCGGCTACTCTTTGAGACCTTGACAGACGGTGGCAATGGTGCTTTCGTTGCTTCTCTCCTTGGAGACGTCGTCTAGGC

Reverse complement sequence

GCCTAGACGACGTCTCCAAGGAGAGAAGCAACGAAAGCACCATTGCCACCGTCTGTCAAGGTCTCAAAGAGTAGCCGAAACTGGGCTTTCGCCCGGTAGC[T/C]
ACACTTGAGGTGGTGAGACGGCACGACAACACCCTCAAGAGGAGAATGACGCCGTCCATCACCTGTCGATCTACCACTGAAGCACCATTGCTCCACCGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	37.80%	1.35%	0.00%	NA
All Indica	2759	77.20%	22.40%	0.36%	0.00%	NA
All Japonica	1512	27.60%	69.00%	3.44%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	57.60%	41.00%	1.34%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	81.60%	18.40%	0.00%	0.00%	NA
Indica Intermediate	786	76.30%	23.50%	0.13%	0.00%	NA
Temperate Japonica	767	19.80%	74.10%	6.13%	0.00%	NA
Tropical Japonica	504	44.00%	55.40%	0.60%	0.00%	NA
Japonica Intermediate	241	17.80%	81.30%	0.83%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	54.40%	43.30%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716538042	A -> G	LOC_Os07g28310.1	upstream_gene_variant ; 3364.0bp to feature; MODIFIER	silent_mutation	Average:64.631; most accessible tissue: Zhenshan97 young leaf, score: 82.982	N	N	N	N
vg0716538042	A -> G	LOC_Os07g28320.1	downstream_gene_variant ; 2689.0bp to feature; MODIFIER	silent_mutation	Average:64.631; most accessible tissue: Zhenshan97 young leaf, score: 82.982	N	N	N	N
vg0716538042	A -> G	LOC_Os07g28320-LOC_Os07g28340	intergenic_region ; MODIFIER	silent_mutation	Average:64.631; most accessible tissue: Zhenshan97 young leaf, score: 82.982	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716538042	NA	1.07E-09	Heading_date	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0716538042	NA	2.13E-07	mr1039_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	9.65E-06	mr1133_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	8.53E-06	mr1298_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	2.29E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	4.75E-07	mr1632_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	5.99E-06	5.99E-06	mr1673_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	2.10E-07	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	3.94E-06	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	NA	2.09E-06	mr1731_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716538042	3.13E-06	1.94E-07	mr1986_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251