\
| Variant ID: vg0716448920 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16448920 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.69, A: 0.31, others allele: 0.00, population size: 65. )
TATATGCTTGACATGTAGGTGCCACCATGACAATGGCACGTCAACGCATGGAGCGGTTTTGAACCCGTTAGGACCTATATGACACACATAACAAGTTTAG[A/G]
GACATAAAAATGCATTTTCGGAGTTCAGGGATCTAGATGACACATATACTTCACTCAAAATTAGATGGCACCAGTCTATGGCACCCATTGCCAGCTGAAA
TTTCAGCTGGCAATGGGTGCCATAGACTGGTGCCATCTAATTTTGAGTGAAGTATATGTGTCATCTAGATCCCTGAACTCCGAAAATGCATTTTTATGTC[T/C]
CTAAACTTGTTATGTGTGTCATATAGGTCCTAACGGGTTCAAAACCGCTCCATGCGTTGACGTGCCATTGTCATGGTGGCACCTACATGTCAAGCATATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.40% | 46.00% | 1.23% | 1.38% | NA |
| All Indica | 2759 | 28.90% | 67.70% | 2.07% | 1.34% | NA |
| All Japonica | 1512 | 97.80% | 0.40% | 0.00% | 1.79% | NA |
| Aus | 269 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 12.80% | 81.20% | 5.71% | 0.34% | NA |
| Indica II | 465 | 76.60% | 23.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 12.00% | 85.90% | 1.31% | 0.77% | NA |
| Indica Intermediate | 786 | 32.60% | 62.50% | 1.40% | 3.56% | NA |
| Temperate Japonica | 767 | 96.20% | 0.30% | 0.00% | 3.52% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 64.40% | 33.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716448920 | A -> DEL | N | N | silent_mutation | Average:48.082; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| vg0716448920 | A -> G | LOC_Os07g28170.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.082; most accessible tissue: Minghui63 young leaf, score: 66.656 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716448920 | NA | 9.49E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 4.85E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 1.26E-18 | mr1441 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 5.64E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 5.11E-14 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 3.58E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 3.42E-28 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716448920 | NA | 1.51E-11 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |