\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716444877:

Variant ID: vg0716444877 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16444877
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TTCCGCAGCACCTTCTGACCTTCCCCTTTGGACTCCTCGGTCAGGGAGAGCGGAACAGGTGCAACAATGGGGGGCGCTAATCGGCGCCTTGGGTGCACGC[C/T]
GCTCGATCCCCACGCACGATGCGCCCTCTCTGTTCCCTGCTCATATATGCGTATGTATATACTTCATCCGTTTCATAATGTAAGTTATTTTAGCATTTCT

Reverse complement sequence

AGAAATGCTAAAATAACTTACATTATGAAACGGATGAAGTATATACATACGCATATATGAGCAGGGAACAGAGAGGGCGCATCGTGCGTGGGGATCGAGC[G/A]
GCGTGCACCCAAGGCGCCGATTAGCGCCCCCCATTGTTGCACCTGTTCCGCTCTCCCTGACCGAGGAGTCCAAAGGGGAAGGTCAGAAGGTGCTGCGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 28.80% 0.04% 1.16% NA
All Indica  2759 51.60% 47.30% 0.07% 1.01% NA
All Japonica  1512 97.90% 0.30% 0.00% 1.79% NA
Aus  269 92.60% 7.40% 0.00% 0.00% NA
Indica I  595 40.80% 59.20% 0.00% 0.00% NA
Indica II  465 90.10% 9.90% 0.00% 0.00% NA
Indica III  913 32.30% 67.60% 0.00% 0.11% NA
Indica Intermediate  786 59.50% 36.80% 0.25% 3.44% NA
Temperate Japonica  767 96.20% 0.30% 0.00% 3.52% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716444877 C -> DEL N N silent_mutation Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0716444877 C -> T LOC_Os07g28170.1 upstream_gene_variant ; 2220.0bp to feature; MODIFIER silent_mutation Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0716444877 C -> T LOC_Os07g28160.1 downstream_gene_variant ; 2736.0bp to feature; MODIFIER silent_mutation Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0716444877 C -> T LOC_Os07g28160-LOC_Os07g28170 intergenic_region ; MODIFIER silent_mutation Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716444877 1.37E-09 3.25E-15 mr1705 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877 3.49E-07 1.38E-08 mr1705 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877 NA 7.72E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877 6.64E-08 6.05E-18 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877 6.04E-06 1.64E-10 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251