| Variant ID: vg0716444877 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16444877 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 72. )
TTCCGCAGCACCTTCTGACCTTCCCCTTTGGACTCCTCGGTCAGGGAGAGCGGAACAGGTGCAACAATGGGGGGCGCTAATCGGCGCCTTGGGTGCACGC[C/T]
GCTCGATCCCCACGCACGATGCGCCCTCTCTGTTCCCTGCTCATATATGCGTATGTATATACTTCATCCGTTTCATAATGTAAGTTATTTTAGCATTTCT
AGAAATGCTAAAATAACTTACATTATGAAACGGATGAAGTATATACATACGCATATATGAGCAGGGAACAGAGAGGGCGCATCGTGCGTGGGGATCGAGC[G/A]
GCGTGCACCCAAGGCGCCGATTAGCGCCCCCCATTGTTGCACCTGTTCCGCTCTCCCTGACCGAGGAGTCCAAAGGGGAAGGTCAGAAGGTGCTGCGGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.00% | 28.80% | 0.04% | 1.16% | NA |
| All Indica | 2759 | 51.60% | 47.30% | 0.07% | 1.01% | NA |
| All Japonica | 1512 | 97.90% | 0.30% | 0.00% | 1.79% | NA |
| Aus | 269 | 92.60% | 7.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 40.80% | 59.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 32.30% | 67.60% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 59.50% | 36.80% | 0.25% | 3.44% | NA |
| Temperate Japonica | 767 | 96.20% | 0.30% | 0.00% | 3.52% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716444877 | C -> DEL | N | N | silent_mutation | Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0716444877 | C -> T | LOC_Os07g28170.1 | upstream_gene_variant ; 2220.0bp to feature; MODIFIER | silent_mutation | Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0716444877 | C -> T | LOC_Os07g28160.1 | downstream_gene_variant ; 2736.0bp to feature; MODIFIER | silent_mutation | Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0716444877 | C -> T | LOC_Os07g28160-LOC_Os07g28170 | intergenic_region ; MODIFIER | silent_mutation | Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716444877 | 1.37E-09 | 3.25E-15 | mr1705 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716444877 | 3.49E-07 | 1.38E-08 | mr1705 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716444877 | NA | 7.72E-06 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716444877 | 6.64E-08 | 6.05E-18 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716444877 | 6.04E-06 | 1.64E-10 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |