Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0716444877:

Variant ID: vg0716444877 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16444877
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TTCCGCAGCACCTTCTGACCTTCCCCTTTGGACTCCTCGGTCAGGGAGAGCGGAACAGGTGCAACAATGGGGGGCGCTAATCGGCGCCTTGGGTGCACGC[C/T]
GCTCGATCCCCACGCACGATGCGCCCTCTCTGTTCCCTGCTCATATATGCGTATGTATATACTTCATCCGTTTCATAATGTAAGTTATTTTAGCATTTCT

Reverse complement sequence

AGAAATGCTAAAATAACTTACATTATGAAACGGATGAAGTATATACATACGCATATATGAGCAGGGAACAGAGAGGGCGCATCGTGCGTGGGGATCGAGC[G/A]
GCGTGCACCCAAGGCGCCGATTAGCGCCCCCCATTGTTGCACCTGTTCCGCTCTCCCTGACCGAGGAGTCCAAAGGGGAAGGTCAGAAGGTGCTGCGGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	28.80%	0.04%	1.16%	NA
All Indica	2759	51.60%	47.30%	0.07%	1.01%	NA
All Japonica	1512	97.90%	0.30%	0.00%	1.79%	NA
Aus	269	92.60%	7.40%	0.00%	0.00%	NA
Indica I	595	40.80%	59.20%	0.00%	0.00%	NA
Indica II	465	90.10%	9.90%	0.00%	0.00%	NA
Indica III	913	32.30%	67.60%	0.00%	0.11%	NA
Indica Intermediate	786	59.50%	36.80%	0.25%	3.44%	NA
Temperate Japonica	767	96.20%	0.30%	0.00%	3.52%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716444877	C -> DEL	N	N	silent_mutation	Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0716444877	C -> T	LOC_Os07g28170.1	upstream_gene_variant ; 2220.0bp to feature; MODIFIER	silent_mutation	Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0716444877	C -> T	LOC_Os07g28160.1	downstream_gene_variant ; 2736.0bp to feature; MODIFIER	silent_mutation	Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N
vg0716444877	C -> T	LOC_Os07g28160-LOC_Os07g28170	intergenic_region ; MODIFIER	silent_mutation	Average:62.364; most accessible tissue: Minghui63 panicle, score: 79.811	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716444877	1.37E-09	3.25E-15	mr1705	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877	3.49E-07	1.38E-08	mr1705	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877	NA	7.72E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877	6.64E-08	6.05E-18	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716444877	6.04E-06	1.64E-10	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251