\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716434420:

Variant ID: vg0716434420 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16434420
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 57. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGTGGCTAATATACCATTTTAACAGGCGTTTCTTGACCCACCTCGGCTCTAGCTGAAGGCTTGTAGAAATAATTGTACAGTCGCACGATAATATCATC[T/C]
GTGAAAATACATTTACATAGGCGGATATTTTAAGTTTCTGCATGCCAAATATGTTTATATAGGCGGATTTGTAGAGGAAACCGCCCATGAAAACCATTTT

Reverse complement sequence

AAAATGGTTTTCATGGGCGGTTTCCTCTACAAATCCGCCTATATAAACATATTTGGCATGCAGAAACTTAAAATATCCGCCTATGTAAATGTATTTTCAC[A/G]
GATGATATTATCGTGCGACTGTACAATTATTTCTACAAGCCTTCAGCTAGAGCCGAGGTGGGTCAAGAAACGCCTGTTAAAATGGTATATTAGCCACCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 36.00% 0.00% 2.52% NA
All Indica  2759 94.70% 3.40% 0.00% 1.96% NA
All Japonica  1512 0.80% 97.40% 0.00% 1.79% NA
Aus  269 80.70% 5.60% 0.00% 13.75% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 96.20% 1.20% 0.00% 2.63% NA
Indica Intermediate  786 87.80% 8.40% 0.00% 3.82% NA
Temperate Japonica  767 0.80% 95.70% 0.00% 3.52% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 83.30% 0.00% 1.04% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716434420 T -> DEL N N silent_mutation Average:42.444; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0716434420 T -> C LOC_Os07g28140.1 upstream_gene_variant ; 1101.0bp to feature; MODIFIER silent_mutation Average:42.444; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0716434420 T -> C LOC_Os07g28160.1 upstream_gene_variant ; 4081.0bp to feature; MODIFIER silent_mutation Average:42.444; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0716434420 T -> C LOC_Os07g28150.1 downstream_gene_variant ; 2318.0bp to feature; MODIFIER silent_mutation Average:42.444; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N
vg0716434420 T -> C LOC_Os07g28130-LOC_Os07g28140 intergenic_region ; MODIFIER silent_mutation Average:42.444; most accessible tissue: Zhenshan97 young leaf, score: 55.261 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716434420 NA 7.43E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 2.92E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.51E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 2.58E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.65E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 2.17E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 5.18E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.80E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 5.91E-66 mr1619 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 8.26E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.94E-30 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.75E-88 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.32E-55 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 4.34E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 5.44E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.66E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 8.57E-37 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.39E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 5.90E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.90E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 3.33E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 2.08E-06 4.22E-07 mr1369_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 4.41E-23 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 2.42E-06 1.92E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 2.74E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 5.93E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 2.50E-35 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 3.16E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.31E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 1.56E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716434420 NA 3.44E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251