\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716418454:

Variant ID: vg0716418454 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16418454
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGAGATAGGTCATCCGTGACGGGCTATAGTTTGACTAGTTGTCTGAGTCAAAGCTATCGGTGACGGGCTTTAATTAGGCCCGATTGAGATAGATTCAT[T/C]
CGTGACGCCCGTTTGTCCGATTGAGATAACTCTTCACATCTGTGACTTCTAGCCTGTGACAGATGCCGTGCCCAATTGAGATGGGGTTTACCGCCCGATT

Reverse complement sequence

AATCGGGCGGTAAACCCCATCTCAATTGGGCACGGCATCTGTCACAGGCTAGAAGTCACAGATGTGAAGAGTTATCTCAATCGGACAAACGGGCGTCACG[A/G]
ATGAATCTATCTCAATCGGGCCTAATTAAAGCCCGTCACCGATAGCTTTGACTCAGACAACTAGTCAAACTATAGCCCGTCACGGATGACCTATCTCAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 13.50% 7.07% 42.28% NA
All Indica  2759 5.00% 22.70% 7.36% 64.95% NA
All Japonica  1512 97.50% 0.20% 0.20% 2.12% NA
Aus  269 7.40% 0.40% 41.64% 50.56% NA
Indica I  595 2.40% 39.80% 1.85% 55.97% NA
Indica II  465 4.10% 2.60% 10.54% 82.80% NA
Indica III  913 2.70% 22.60% 9.97% 64.73% NA
Indica Intermediate  786 10.10% 21.90% 6.62% 61.45% NA
Temperate Japonica  767 95.80% 0.30% 0.13% 3.78% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 0.00% 0.83% 0.83% NA
VI/Aromatic  96 83.30% 0.00% 12.50% 4.17% NA
Intermediate  90 52.20% 5.60% 4.44% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716418454 T -> DEL N N silent_mutation Average:56.791; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0716418454 T -> C LOC_Os07g28130.1 upstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:56.791; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N
vg0716418454 T -> C LOC_Os07g28120-LOC_Os07g28130 intergenic_region ; MODIFIER silent_mutation Average:56.791; most accessible tissue: Zhenshan97 panicle, score: 86.058 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716418454 NA 2.89E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 5.45E-29 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 2.58E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 3.59E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 1.78E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 4.43E-06 NA mr1265_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 1.08E-08 1.93E-09 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 4.65E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 8.36E-06 NA mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 5.59E-08 1.66E-08 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 4.65E-32 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716418454 NA 4.01E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251