Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716416858:

Variant ID: vg0716416858 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16416858
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGTGACGGGCACTAACTTTAGACCCGATTGACATAACATTCCACATCTCAAACAGGCCTCAAGTTGTGGCCCATCATCAGTGACGTGCACCAACTTGAG[A/G]
CCCGTTTGAGATAACTACTAGGGCCGTCACAGATGACTCATCAGTGACGGGCCATATACTTAATCTCTATCGGGTATTAACTAAAGCCCGTCACCGATGA

Reverse complement sequence

TCATCGGTGACGGGCTTTAGTTAATACCCGATAGAGATTAAGTATATGGCCCGTCACTGATGAGTCATCTGTGACGGCCCTAGTAGTTATCTCAAACGGG[T/C]
CTCAAGTTGGTGCACGTCACTGATGATGGGCCACAACTTGAGGCCTGTTTGAGATGTGGAATGTTATGTCAATCGGGTCTAAAGTTAGTGCCCGTCACAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.70%	37.20%	2.12%	3.98%	NA
All Indica	2759	87.10%	3.80%	3.41%	5.65%	NA
All Japonica	1512	0.70%	97.40%	0.00%	1.92%	NA
Aus	269	79.90%	19.70%	0.37%	0.00%	NA
Indica I	595	90.30%	1.00%	2.35%	6.39%	NA
Indica II	465	89.50%	2.80%	2.37%	5.38%	NA
Indica III	913	90.00%	1.80%	4.82%	3.40%	NA
Indica Intermediate	786	79.90%	9.00%	3.18%	7.89%	NA
Temperate Japonica	767	0.50%	95.70%	0.00%	3.78%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	15.60%	84.40%	0.00%	0.00%	NA
Intermediate	90	43.30%	47.80%	5.56%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716416858	A -> DEL	N	N	silent_mutation	Average:15.829; most accessible tissue: Callus, score: 30.663	N	N	N	N
vg0716416858	A -> G	LOC_Os07g28130.1	upstream_gene_variant ; 3015.0bp to feature; MODIFIER	silent_mutation	Average:15.829; most accessible tissue: Callus, score: 30.663	N	N	N	N
vg0716416858	A -> G	LOC_Os07g28120-LOC_Os07g28130	intergenic_region ; MODIFIER	silent_mutation	Average:15.829; most accessible tissue: Callus, score: 30.663	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716416858	NA	7.74E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	2.24E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	3.95E-22	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.25E-29	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	5.11E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.17E-26	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	3.79E-69	mr1538	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.56E-19	mr1541	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	8.16E-45	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	9.27E-60	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.39E-72	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	9.31E-12	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	5.61E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	7.20E-30	mr1737	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	4.23E-07	mr1785	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.66E-54	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	3.69E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	4.67E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.58E-38	mr1890	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	2.16E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.62E-27	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.90E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	9.43E-06	mr1329_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	3.09E-06	6.54E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	6.28E-25	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	1.36E-06	2.01E-07	mr1453_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	7.52E-06	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.69E-31	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.31E-07	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	1.10E-33	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	7.93E-32	mr1873_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716416858	NA	4.82E-21	mr1924_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251