\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716398948:

Variant ID: vg0716398948 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 16398948
Reference Allele: CAAlternative Allele: C,CAA,CAAA,AA
Primary Allele: CASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAATTCTTTCTATTCGATTGTTTCTCTGTAACTCTGTAAATATTTTTTGAGTTTTATAAAATTAACACTGCTGGGCAAAGCCCTGGCAGTATTCCCAGT[CA/C,CAA,CAAA,AA]
AAAAAAAAAGAGCCGCACTAGTAAGGGTTTCTTAGGCGCTGATGCCACCGCGCCATTGTGTATCAAGGGCAACATTGGTGGCAACTCTGGTGACGATCCG

Reverse complement sequence

CGGATCGTCACCAGAGTTGCCACCAATGTTGCCCTTGATACACAATGGCGCGGTGGCATCAGCGCCTAAGAAACCCTTACTAGTGCGGCTCTTTTTTTTT[TG/G,TTG,TTTG,TT]
ACTGGGAATACTGCCAGGGCTTTGCCCAGCAGTGTTAATTTTATAAAACTCAAAAAATATTTACAGAGTTACAGAGAAACAATCGAATAGAAAGAATTTA

Allele Frequencies:

Populations Population SizeFrequency of CA(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.90% 36.90% 2.31% 1.16% CAA: 12.89%; AA: 7.13%; CAAA: 0.72%
All Indica  2759 19.80% 55.70% 2.57% 1.01% CAA: 20.55%; AA: 0.33%; CAAA: 0.11%
All Japonica  1512 74.50% 0.30% 1.85% 1.79% AA: 21.16%; CAA: 0.33%; CAAA: 0.07%
Aus  269 14.90% 65.80% 1.86% 0.00% CAA: 10.41%; CAAA: 7.06%
Indica I  595 3.00% 65.20% 3.70% 0.00% CAA: 28.07%
Indica II  465 68.60% 16.30% 2.58% 0.00% CAA: 12.04%; AA: 0.43%
Indica III  913 3.70% 77.70% 0.66% 0.11% CAA: 17.52%; CAAA: 0.22%; AA: 0.11%
Indica Intermediate  786 22.10% 46.20% 3.94% 3.44% CAA: 23.41%; AA: 0.76%; CAAA: 0.13%
Temperate Japonica  767 91.50% 0.30% 0.91% 3.52% AA: 3.26%; CAA: 0.52%
Tropical Japonica  504 43.70% 0.40% 3.77% 0.00% AA: 51.98%; CAA: 0.20%
Japonica Intermediate  241 84.60% 0.40% 0.83% 0.00% AA: 13.69%; CAAA: 0.41%
VI/Aromatic  96 83.30% 1.00% 1.04% 0.00% CAAA: 11.46%; CAA: 3.12%
Intermediate  90 51.10% 28.90% 4.44% 0.00% AA: 8.89%; CAA: 6.67%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716398948 CA -> CAAA LOC_Os07g28100.1 upstream_gene_variant ; 4082.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAAA LOC_Os07g28110.1 downstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAAA LOC_Os07g28120.1 downstream_gene_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAAA LOC_Os07g28110-LOC_Os07g28120 intergenic_region ; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> AA LOC_Os07g28100.1 upstream_gene_variant ; 4080.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> AA LOC_Os07g28110.1 downstream_gene_variant ; 1249.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> AA LOC_Os07g28120.1 downstream_gene_variant ; 223.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> AA LOC_Os07g28110-LOC_Os07g28120 intergenic_region ; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> C LOC_Os07g28100.1 upstream_gene_variant ; 4081.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> C LOC_Os07g28110.1 downstream_gene_variant ; 1250.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> C LOC_Os07g28120.1 downstream_gene_variant ; 222.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> C LOC_Os07g28110-LOC_Os07g28120 intergenic_region ; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAA LOC_Os07g28100.1 upstream_gene_variant ; 4082.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAA LOC_Os07g28110.1 downstream_gene_variant ; 1251.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAA LOC_Os07g28120.1 downstream_gene_variant ; 221.0bp to feature; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> CAA LOC_Os07g28110-LOC_Os07g28120 intergenic_region ; MODIFIER silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N
vg0716398948 CA -> DEL N N silent_mutation Average:45.769; most accessible tissue: Callus, score: 68.643 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716398948 NA 1.23E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 NA 4.07E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 NA 8.62E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 NA 4.77E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 2.96E-07 NA mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 3.90E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 3.68E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 6.61E-07 NA mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 NA 1.29E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716398948 NA 3.17E-06 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251