\
| Variant ID: vg0716398948 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 16398948 |
| Reference Allele: CA | Alternative Allele: C,CAA,CAAA,AA |
| Primary Allele: CA | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAAATTCTTTCTATTCGATTGTTTCTCTGTAACTCTGTAAATATTTTTTGAGTTTTATAAAATTAACACTGCTGGGCAAAGCCCTGGCAGTATTCCCAGT[CA/C,CAA,CAAA,AA]
AAAAAAAAAGAGCCGCACTAGTAAGGGTTTCTTAGGCGCTGATGCCACCGCGCCATTGTGTATCAAGGGCAACATTGGTGGCAACTCTGGTGACGATCCG
CGGATCGTCACCAGAGTTGCCACCAATGTTGCCCTTGATACACAATGGCGCGGTGGCATCAGCGCCTAAGAAACCCTTACTAGTGCGGCTCTTTTTTTTT[TG/G,TTG,TTTG,TT]
ACTGGGAATACTGCCAGGGCTTTGCCCAGCAGTGTTAATTTTATAAAACTCAAAAAATATTTACAGAGTTACAGAGAAACAATCGAATAGAAAGAATTTA
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.90% | 36.90% | 2.31% | 1.16% | CAA: 12.89%; AA: 7.13%; CAAA: 0.72% |
| All Indica | 2759 | 19.80% | 55.70% | 2.57% | 1.01% | CAA: 20.55%; AA: 0.33%; CAAA: 0.11% |
| All Japonica | 1512 | 74.50% | 0.30% | 1.85% | 1.79% | AA: 21.16%; CAA: 0.33%; CAAA: 0.07% |
| Aus | 269 | 14.90% | 65.80% | 1.86% | 0.00% | CAA: 10.41%; CAAA: 7.06% |
| Indica I | 595 | 3.00% | 65.20% | 3.70% | 0.00% | CAA: 28.07% |
| Indica II | 465 | 68.60% | 16.30% | 2.58% | 0.00% | CAA: 12.04%; AA: 0.43% |
| Indica III | 913 | 3.70% | 77.70% | 0.66% | 0.11% | CAA: 17.52%; CAAA: 0.22%; AA: 0.11% |
| Indica Intermediate | 786 | 22.10% | 46.20% | 3.94% | 3.44% | CAA: 23.41%; AA: 0.76%; CAAA: 0.13% |
| Temperate Japonica | 767 | 91.50% | 0.30% | 0.91% | 3.52% | AA: 3.26%; CAA: 0.52% |
| Tropical Japonica | 504 | 43.70% | 0.40% | 3.77% | 0.00% | AA: 51.98%; CAA: 0.20% |
| Japonica Intermediate | 241 | 84.60% | 0.40% | 0.83% | 0.00% | AA: 13.69%; CAAA: 0.41% |
| VI/Aromatic | 96 | 83.30% | 1.00% | 1.04% | 0.00% | CAAA: 11.46%; CAA: 3.12% |
| Intermediate | 90 | 51.10% | 28.90% | 4.44% | 0.00% | AA: 8.89%; CAA: 6.67% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716398948 | CA -> CAAA | LOC_Os07g28100.1 | upstream_gene_variant ; 4082.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAAA | LOC_Os07g28110.1 | downstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAAA | LOC_Os07g28120.1 | downstream_gene_variant ; 221.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAAA | LOC_Os07g28110-LOC_Os07g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> AA | LOC_Os07g28100.1 | upstream_gene_variant ; 4080.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> AA | LOC_Os07g28110.1 | downstream_gene_variant ; 1249.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> AA | LOC_Os07g28120.1 | downstream_gene_variant ; 223.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> AA | LOC_Os07g28110-LOC_Os07g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> C | LOC_Os07g28100.1 | upstream_gene_variant ; 4081.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> C | LOC_Os07g28110.1 | downstream_gene_variant ; 1250.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> C | LOC_Os07g28120.1 | downstream_gene_variant ; 222.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> C | LOC_Os07g28110-LOC_Os07g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAA | LOC_Os07g28100.1 | upstream_gene_variant ; 4082.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAA | LOC_Os07g28110.1 | downstream_gene_variant ; 1251.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAA | LOC_Os07g28120.1 | downstream_gene_variant ; 221.0bp to feature; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> CAA | LOC_Os07g28110-LOC_Os07g28120 | intergenic_region ; MODIFIER | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| vg0716398948 | CA -> DEL | N | N | silent_mutation | Average:45.769; most accessible tissue: Callus, score: 68.643 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716398948 | NA | 1.23E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | NA | 4.07E-06 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | NA | 8.62E-09 | mr1533 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | NA | 4.77E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | 2.96E-07 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | 3.90E-06 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | 3.68E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | 6.61E-07 | NA | mr1241_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | NA | 1.29E-10 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716398948 | NA | 3.17E-06 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |