Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0716393936:

Variant ID: vg0716393936 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16393936
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACGGAAAAAGCCAACCGATGAGGCCCTGAGTATTAATTATTATAAAATTAAAAAAATAGATTAATAATATTTTTTCAATTAACTTTTCTATATGAAATA[T/A]
TTGGAAAATAATATGAAAGCATCAGCAAGGAAAACGAGTGAATTTTTATCCTTATCTTCTCCTAAAGATCGAACGCTAAACATAACTATTTAGTTGTTCA

Reverse complement sequence

TGAACAACTAAATAGTTATGTTTAGCGTTCGATCTTTAGGAGAAGATAAGGATAAAAATTCACTCGTTTTCCTTGCTGATGCTTTCATATTATTTTCCAA[A/T]
TATTTCATATAGAAAAGTTAATTGAAAAAATATTATTAATCTATTTTTTTAATTTTATAATAATTAATACTCAGGGCCTCATCGGTTGGCTTTTTCCGTA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.30%	10.00%	1.46%	1.21%	NA
All Indica	2759	98.00%	0.80%	0.11%	1.09%	NA
All Japonica	1512	66.00%	28.20%	3.97%	1.79%	NA
Aus	269	94.10%	5.60%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.22%	0.00%	NA
Indica III	913	99.80%	0.10%	0.00%	0.11%	NA
Indica Intermediate	786	94.00%	2.00%	0.25%	3.69%	NA
Temperate Japonica	767	81.20%	10.30%	4.95%	3.52%	NA
Tropical Japonica	504	37.90%	60.30%	1.79%	0.00%	NA
Japonica Intermediate	241	76.30%	18.30%	5.39%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	10.00%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716393936	T -> DEL	N	N	silent_mutation	Average:34.459; most accessible tissue: Callus, score: 58.753	N	N	N	N
vg0716393936	T -> A	LOC_Os07g28110.1	upstream_gene_variant ; 2249.0bp to feature; MODIFIER	silent_mutation	Average:34.459; most accessible tissue: Callus, score: 58.753	N	N	N	N
vg0716393936	T -> A	LOC_Os07g28100.1	downstream_gene_variant ; 495.0bp to feature; MODIFIER	silent_mutation	Average:34.459; most accessible tissue: Callus, score: 58.753	N	N	N	N
vg0716393936	T -> A	LOC_Os07g28090-LOC_Os07g28100	intergenic_region ; MODIFIER	silent_mutation	Average:34.459; most accessible tissue: Callus, score: 58.753	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716393936	NA	7.75E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	5.44E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	1.97E-07	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	9.59E-10	mr1905	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	7.88E-10	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	2.85E-06	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	5.50E-09	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	7.48E-07	7.36E-16	mr1705_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	2.79E-06	9.33E-11	mr1705_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	2.23E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	4.05E-10	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936	NA	5.87E-07	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251