\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716393936:

Variant ID: vg0716393936 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16393936
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGGAAAAAGCCAACCGATGAGGCCCTGAGTATTAATTATTATAAAATTAAAAAAATAGATTAATAATATTTTTTCAATTAACTTTTCTATATGAAATA[T/A]
TTGGAAAATAATATGAAAGCATCAGCAAGGAAAACGAGTGAATTTTTATCCTTATCTTCTCCTAAAGATCGAACGCTAAACATAACTATTTAGTTGTTCA

Reverse complement sequence

TGAACAACTAAATAGTTATGTTTAGCGTTCGATCTTTAGGAGAAGATAAGGATAAAAATTCACTCGTTTTCCTTGCTGATGCTTTCATATTATTTTCCAA[A/T]
TATTTCATATAGAAAAGTTAATTGAAAAAATATTATTAATCTATTTTTTTAATTTTATAATAATTAATACTCAGGGCCTCATCGGTTGGCTTTTTCCGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 10.00% 1.46% 1.21% NA
All Indica  2759 98.00% 0.80% 0.11% 1.09% NA
All Japonica  1512 66.00% 28.20% 3.97% 1.79% NA
Aus  269 94.10% 5.60% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 94.00% 2.00% 0.25% 3.69% NA
Temperate Japonica  767 81.20% 10.30% 4.95% 3.52% NA
Tropical Japonica  504 37.90% 60.30% 1.79% 0.00% NA
Japonica Intermediate  241 76.30% 18.30% 5.39% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 85.60% 10.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716393936 T -> DEL N N silent_mutation Average:34.459; most accessible tissue: Callus, score: 58.753 N N N N
vg0716393936 T -> A LOC_Os07g28110.1 upstream_gene_variant ; 2249.0bp to feature; MODIFIER silent_mutation Average:34.459; most accessible tissue: Callus, score: 58.753 N N N N
vg0716393936 T -> A LOC_Os07g28100.1 downstream_gene_variant ; 495.0bp to feature; MODIFIER silent_mutation Average:34.459; most accessible tissue: Callus, score: 58.753 N N N N
vg0716393936 T -> A LOC_Os07g28090-LOC_Os07g28100 intergenic_region ; MODIFIER silent_mutation Average:34.459; most accessible tissue: Callus, score: 58.753 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716393936 NA 7.75E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 5.44E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 1.97E-07 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 9.59E-10 mr1905 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 7.88E-10 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 2.85E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 5.50E-09 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 7.48E-07 7.36E-16 mr1705_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 2.79E-06 9.33E-11 mr1705_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 2.23E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 4.05E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716393936 NA 5.87E-07 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251