\
| Variant ID: vg0716393936 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16393936 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACGGAAAAAGCCAACCGATGAGGCCCTGAGTATTAATTATTATAAAATTAAAAAAATAGATTAATAATATTTTTTCAATTAACTTTTCTATATGAAATA[T/A]
TTGGAAAATAATATGAAAGCATCAGCAAGGAAAACGAGTGAATTTTTATCCTTATCTTCTCCTAAAGATCGAACGCTAAACATAACTATTTAGTTGTTCA
TGAACAACTAAATAGTTATGTTTAGCGTTCGATCTTTAGGAGAAGATAAGGATAAAAATTCACTCGTTTTCCTTGCTGATGCTTTCATATTATTTTCCAA[A/T]
TATTTCATATAGAAAAGTTAATTGAAAAAATATTATTAATCTATTTTTTTAATTTTATAATAATTAATACTCAGGGCCTCATCGGTTGGCTTTTTCCGTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 10.00% | 1.46% | 1.21% | NA |
| All Indica | 2759 | 98.00% | 0.80% | 0.11% | 1.09% | NA |
| All Japonica | 1512 | 66.00% | 28.20% | 3.97% | 1.79% | NA |
| Aus | 269 | 94.10% | 5.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 94.00% | 2.00% | 0.25% | 3.69% | NA |
| Temperate Japonica | 767 | 81.20% | 10.30% | 4.95% | 3.52% | NA |
| Tropical Japonica | 504 | 37.90% | 60.30% | 1.79% | 0.00% | NA |
| Japonica Intermediate | 241 | 76.30% | 18.30% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716393936 | T -> DEL | N | N | silent_mutation | Average:34.459; most accessible tissue: Callus, score: 58.753 | N | N | N | N |
| vg0716393936 | T -> A | LOC_Os07g28110.1 | upstream_gene_variant ; 2249.0bp to feature; MODIFIER | silent_mutation | Average:34.459; most accessible tissue: Callus, score: 58.753 | N | N | N | N |
| vg0716393936 | T -> A | LOC_Os07g28100.1 | downstream_gene_variant ; 495.0bp to feature; MODIFIER | silent_mutation | Average:34.459; most accessible tissue: Callus, score: 58.753 | N | N | N | N |
| vg0716393936 | T -> A | LOC_Os07g28090-LOC_Os07g28100 | intergenic_region ; MODIFIER | silent_mutation | Average:34.459; most accessible tissue: Callus, score: 58.753 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716393936 | NA | 7.75E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 5.44E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 1.97E-07 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 9.59E-10 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 7.88E-10 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 2.85E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 5.50E-09 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | 7.48E-07 | 7.36E-16 | mr1705_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | 2.79E-06 | 9.33E-11 | mr1705_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 2.23E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 4.05E-10 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716393936 | NA | 5.87E-07 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |