\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716392399:

Variant ID: vg0716392399 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16392399
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTTATGGAGTTGACAGTCAGTACTCACCCTCTCCCCCCGCGTTGTCCACGCGCGGGCGACATGGGAAAATCCCTAGCCGCCCCGTTTTTCTGATGGA[G/T]
CACACCGCCGGAAATCGGGCAACATGCTAGAATGGCAGGGGTGGGGTCATAACCCGACGATGCTTAGTCTCTAGTGCGGGGCAGAATGAGTTAAGCTAAA

Reverse complement sequence

TTTAGCTTAACTCATTCTGCCCCGCACTAGAGACTAAGCATCGTCGGGTTATGACCCCACCCCTGCCATTCTAGCATGTTGCCCGATTTCCGGCGGTGTG[C/A]
TCCATCAGAAAAACGGGGCGGCTAGGGATTTTCCCATGTCGCCCGCGCGTGGACAACGCGGGGGGAGAGGGTGAGTACTGACTGTCAACTCCATAAAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 8.50% 0.19% 1.14% NA
All Indica  2759 98.20% 0.70% 0.14% 0.98% NA
All Japonica  1512 74.20% 23.70% 0.33% 1.79% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 99.80% 0.10% 0.00% 0.11% NA
Indica Intermediate  786 94.40% 1.90% 0.38% 3.31% NA
Temperate Japonica  767 92.80% 3.70% 0.00% 3.52% NA
Tropical Japonica  504 40.50% 58.70% 0.79% 0.00% NA
Japonica Intermediate  241 85.50% 14.10% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716392399 G -> DEL N N silent_mutation Average:69.913; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0716392399 G -> T LOC_Os07g28110.1 upstream_gene_variant ; 3786.0bp to feature; MODIFIER silent_mutation Average:69.913; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0716392399 G -> T LOC_Os07g28090.1 downstream_gene_variant ; 4953.0bp to feature; MODIFIER silent_mutation Average:69.913; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0716392399 G -> T LOC_Os07g28100.1 downstream_gene_variant ; 2032.0bp to feature; MODIFIER silent_mutation Average:69.913; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N
vg0716392399 G -> T LOC_Os07g28090-LOC_Os07g28100 intergenic_region ; MODIFIER silent_mutation Average:69.913; most accessible tissue: Zhenshan97 young leaf, score: 88.127 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716392399 NA 2.37E-07 mr1229 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716392399 NA 1.22E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716392399 NA 8.03E-10 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716392399 NA 8.01E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251