\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716391496:

Variant ID: vg0716391496 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16391496
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.10, G: 0.04, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


ACATCAGTGGCTGTAATGGAAGTACCATTATGGTAGAGGATGTGAACCCCTCACGCGGATGGATGTCTACTTATTGCATAATTTAGATTTTATAAACATC[C/G,T]
GTATGAATTTGGACACGTATATAAAATACATATATCGATCCATACATAAACCTATTCAAAACTTAAAATGTTTTTATAATAGAAACATAAATATACTAGA

Reverse complement sequence

TCTAGTATATTTATGTTTCTATTATAAAAACATTTTAAGTTTTGAATAGGTTTATGTATGGATCGATATATGTATTTTATATACGTGTCCAAATTCATAC[G/C,A]
GATGTTTATAAAATCTAAATTATGCAATAAGTAGACATCCATCCGCGTGAGGGGTTCACATCCTCTACCATAATGGTACTTCCATTACAGCCACTGATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 28.60% 0.08% 1.14% T: 0.74%
All Indica  2759 50.70% 48.10% 0.14% 0.98% T: 0.04%
All Japonica  1512 97.90% 0.30% 0.00% 1.79% T: 0.07%
Aus  269 92.20% 0.40% 0.00% 0.00% T: 7.43%
Indica I  595 40.80% 59.20% 0.00% 0.00% NA
Indica II  465 85.20% 14.80% 0.00% 0.00% NA
Indica III  913 33.10% 66.70% 0.11% 0.11% NA
Indica Intermediate  786 58.40% 37.80% 0.38% 3.31% T: 0.13%
Temperate Japonica  767 96.20% 0.30% 0.00% 3.52% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.00% T: 0.41%
VI/Aromatic  96 86.50% 0.00% 0.00% 0.00% T: 13.54%
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716391496 C -> DEL N N silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> G LOC_Os07g28110.1 upstream_gene_variant ; 4689.0bp to feature; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> G LOC_Os07g28090.1 downstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> G LOC_Os07g28100.1 downstream_gene_variant ; 2935.0bp to feature; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> G LOC_Os07g28090-LOC_Os07g28100 intergenic_region ; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> T LOC_Os07g28110.1 upstream_gene_variant ; 4689.0bp to feature; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> T LOC_Os07g28090.1 downstream_gene_variant ; 4050.0bp to feature; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> T LOC_Os07g28100.1 downstream_gene_variant ; 2935.0bp to feature; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N
vg0716391496 C -> T LOC_Os07g28090-LOC_Os07g28100 intergenic_region ; MODIFIER silent_mutation Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716391496 2.43E-08 6.50E-14 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716391496 4.18E-06 1.62E-07 mr1705 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716391496 1.79E-09 8.42E-19 mr1705_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716391496 8.72E-08 1.19E-11 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251