Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716391496:

Variant ID: vg0716391496 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16391496
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.10, G: 0.04, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:

ACATCAGTGGCTGTAATGGAAGTACCATTATGGTAGAGGATGTGAACCCCTCACGCGGATGGATGTCTACTTATTGCATAATTTAGATTTTATAAACATC[C/G,T]
GTATGAATTTGGACACGTATATAAAATACATATATCGATCCATACATAAACCTATTCAAAACTTAAAATGTTTTTATAATAGAAACATAAATATACTAGA

Reverse complement sequence

TCTAGTATATTTATGTTTCTATTATAAAAACATTTTAAGTTTTGAATAGGTTTATGTATGGATCGATATATGTATTTTATATACGTGTCCAAATTCATAC[G/C,A]
GATGTTTATAAAATCTAAATTATGCAATAAGTAGACATCCATCCGCGTGAGGGGTTCACATCCTCTACCATAATGGTACTTCCATTACAGCCACTGATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.40%	28.60%	0.08%	1.14%	T: 0.74%
All Indica	2759	50.70%	48.10%	0.14%	0.98%	T: 0.04%
All Japonica	1512	97.90%	0.30%	0.00%	1.79%	T: 0.07%
Aus	269	92.20%	0.40%	0.00%	0.00%	T: 7.43%
Indica I	595	40.80%	59.20%	0.00%	0.00%	NA
Indica II	465	85.20%	14.80%	0.00%	0.00%	NA
Indica III	913	33.10%	66.70%	0.11%	0.11%	NA
Indica Intermediate	786	58.40%	37.80%	0.38%	3.31%	T: 0.13%
Temperate Japonica	767	96.20%	0.30%	0.00%	3.52%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.00%	T: 0.41%
VI/Aromatic	96	86.50%	0.00%	0.00%	0.00%	T: 13.54%
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716391496	C -> DEL	N	N	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> G	LOC_Os07g28110.1	upstream_gene_variant ; 4689.0bp to feature; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> G	LOC_Os07g28090.1	downstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> G	LOC_Os07g28100.1	downstream_gene_variant ; 2935.0bp to feature; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> G	LOC_Os07g28090-LOC_Os07g28100	intergenic_region ; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> T	LOC_Os07g28110.1	upstream_gene_variant ; 4689.0bp to feature; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> T	LOC_Os07g28090.1	downstream_gene_variant ; 4050.0bp to feature; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> T	LOC_Os07g28100.1	downstream_gene_variant ; 2935.0bp to feature; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0716391496	C -> T	LOC_Os07g28090-LOC_Os07g28100	intergenic_region ; MODIFIER	silent_mutation	Average:59.899; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716391496	2.43E-08	6.50E-14	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716391496	4.18E-06	1.62E-07	mr1705	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716391496	1.79E-09	8.42E-19	mr1705_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716391496	8.72E-08	1.19E-11	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251