Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716362688:

Variant ID: vg0716362688 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 16362688
Reference Allele: ACCAGCCCCAGTGAATCTATCGGCTAC	Alternative Allele: GCCAGCCCCAGTGAATCTATCGGCTAC,A
Primary Allele: GCCAGCCCCAGTGAATCTAT CGGCTAC	Secondary Allele: ACCAGCCCCAGTGAATCTAT CGGCTAC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCCCGAGGTTTTACTTATCAACCGGCAGAATTTGGCACCTGACGCGGGGCTGCATCTGTTCAGTTCGATCTCCGGCGAAGGGGTAAGTCCTACATTCC[ACCAGCCCCAGTGAATCTATCGGCTAC/GCCAGCCCCAGTGAATCTATCGGCTAC,A]
ATTGATGTTGTTCAAGGTTGCATCGCTTCGATCTCTTGGATCGCTCTGGTTTGGTCGATATATTTGCCTACCTGATATCTCAATTCTATCTCTAATTGCA

Reverse complement sequence

TGCAATTAGAGATAGAATTGAGATATCAGGTAGGCAAATATATCGACCAAACCAGAGCGATCCAAGAGATCGAAGCGATGCAACCTTGAACAACATCAAT[GTAGCCGATAGATTCACTGGGGCTGGT/GTAGCCGATAGATTCACTGGGGCTGGC,T]
GGAATGTAGGACTTACCCCTTCGCCGGAGATCGAACTGAACAGATGCAGCCCCGCGTCAGGTGCCAAATTCTGCCGGTTGATAAGTAAAACCTCGGGAAA

Allele Frequencies:

Populations	Population Size	Frequency of GCCAGCCCCAGTGAATCTAT CGGCTAC(primary allele)	Frequency of ACCAGCCCCAGTGAATCTAT CGGCTAC(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.70%	37.30%	0.00%	0.00%	NA
All Indica	2759	95.70%	4.30%	0.00%	0.00%	NA
All Japonica	1512	0.70%	99.30%	0.00%	0.00%	NA
Aus	269	94.10%	5.90%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	88.50%	11.50%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	17.70%	82.30%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716362688	ACCAGCCCCAGTGAATCTATCGGCTAC -> GCCAGCCCCAGTGAATCTATCGGCTAC	LOC_Os07g28050.1	intron_variant ; MODIFIER	silent_mutation	Average:37.672; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N
vg0716362688	ACCAGCCCCAGTGAATCTATCGGCTAC -> A	LOC_Os07g28050.1	intron_variant ; MODIFIER	N	Average:37.672; most accessible tissue: Zhenshan97 flag leaf, score: 61.926	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716362688	NA	2.40E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	1.19E-09	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	7.47E-27	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	4.71E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	3.34E-58	mr1594	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	9.15E-75	mr1629	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	3.98E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	3.94E-51	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	9.08E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	9.16E-23	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	5.04E-40	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	2.62E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	3.95E-37	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	5.11E-36	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	9.02E-11	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	4.80E-06	NA	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	1.72E-10	2.10E-11	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	9.56E-07	NA	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	2.35E-10	5.50E-11	mr1528_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	3.73E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	6.58E-22	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	6.87E-20	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	4.62E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	4.09E-35	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716362688	NA	3.08E-31	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251