\
| Variant ID: vg0716355931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16355931 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )
TTTGCATGCATCCAAAAGACCTTTTTGTTTTCTACAAGTTGAGCAAGAAAACACCTCATCTTGTTTAACAATTTCTTCCATGTGATTAACACGCTCTAAA[G/T]
CATCTTTCAACTTCAACTCATTCAAACCACACTTTGAACAATATTGAGAAATCAAAGCACCATTGTTTTGTTTTGCCTTATTTGCACATGAAACATTGAC
GTCAATGTTTCATGTGCAAATAAGGCAAAACAAAACAATGGTGCTTTGATTTCTCAATATTGTTCAAAGTGTGGTTTGAATGAGTTGAAGTTGAAAGATG[C/A]
TTTAGAGCGTGTTAATCACATGGAAGAAATTGTTAAACAAGATGAGGTGTTTTCTTGCTCAACTTGTAGAAAACAAAAAGGTCTTTTGGATGCATGCAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 7.60% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 76.10% | 22.30% | 1.59% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.80% | 3.30% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 41.90% | 55.00% | 3.17% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.10% | 14.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 11.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716355931 | G -> T | LOC_Os07g28050.1 | missense_variant ; p.Ala858Asp; MODERATE | nonsynonymous_codon ; A858D | Average:20.714; most accessible tissue: Minghui63 flag leaf, score: 29.435 | probably damaging |
2.068 |
DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716355931 | NA | 2.37E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 4.36E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 4.79E-10 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 1.07E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 1.31E-13 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 6.74E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | 6.15E-07 | 3.60E-15 | mr1705_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 2.75E-09 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 2.65E-08 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716355931 | NA | 2.71E-10 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |