\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716351837:

Variant ID: vg0716351837 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16351837
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


GTAGGATAAGGTTGACACACAGAAGAAAGAACCAATGTATTCTTCACTAAAATATAATCTAGGCTAAGTGGAGGAAGAATAAGAAAAGAATCATTCCTAT[A/G]
CTTCCTGTATATAGTTAATTTAGTTTACACTTGCTAGTATACAATCATGCAACCAATACCCCGTAATTATGCTCTCCTAGTGTTTCAACAGACCACCCCT

Reverse complement sequence

AGGGGTGGTCTGTTGAAACACTAGGAGAGCATAATTACGGGGTATTGGTTGCATGATTGTATACTAGCAAGTGTAAACTAAATTAACTATATACAGGAAG[T/C]
ATAGGAATGATTCTTTTCTTATTCTTCCTCCACTTAGCCTAGATTATATTTTAGTGAAGAATACATTGGTTCTTTCTTCTGTGTGTCAACCTTATCCTAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.80% 28.70% 0.78% 0.72% NA
All Indica  2759 50.30% 48.40% 1.05% 0.33% NA
All Japonica  1512 99.80% 0.10% 0.00% 0.07% NA
Aus  269 92.20% 0.40% 2.60% 4.83% NA
Indica I  595 41.70% 58.20% 0.17% 0.00% NA
Indica II  465 84.30% 14.60% 0.86% 0.22% NA
Indica III  913 29.00% 68.00% 2.19% 0.77% NA
Indica Intermediate  786 61.30% 38.00% 0.51% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 88.50% 0.00% 0.00% 11.46% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716351837 A -> DEL N N silent_mutation Average:50.471; most accessible tissue: Minghui63 flag leaf, score: 89.523 N N N N
vg0716351837 A -> G LOC_Os07g28040.1 upstream_gene_variant ; 2326.0bp to feature; MODIFIER silent_mutation Average:50.471; most accessible tissue: Minghui63 flag leaf, score: 89.523 N N N N
vg0716351837 A -> G LOC_Os07g28040.2 upstream_gene_variant ; 2326.0bp to feature; MODIFIER silent_mutation Average:50.471; most accessible tissue: Minghui63 flag leaf, score: 89.523 N N N N
vg0716351837 A -> G LOC_Os07g28050.1 downstream_gene_variant ; 1419.0bp to feature; MODIFIER silent_mutation Average:50.471; most accessible tissue: Minghui63 flag leaf, score: 89.523 N N N N
vg0716351837 A -> G LOC_Os07g28040-LOC_Os07g28050 intergenic_region ; MODIFIER silent_mutation Average:50.471; most accessible tissue: Minghui63 flag leaf, score: 89.523 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0716351837 A G 0.06 -0.01 -0.01 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716351837 NA 5.10E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716351837 NA 5.69E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716351837 1.57E-07 3.18E-10 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716351837 9.64E-08 6.52E-09 mr1705 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716351837 NA 1.12E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716351837 1.01E-06 1.56E-12 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716351837 8.41E-07 2.64E-11 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251