\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716330932:

Variant ID: vg0716330932 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16330932
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAAGTATTTCTGCGCCATTGCTGGGAATTATATTTCTAGTAATGTCGTTAAGAAATACCAACAATTATGAACTCCTCCCTAGCTTTATAGCCATGGTT[T/C]
GGGACCAATCCTTCTCCAGACTTGACCATGAAAAATCTATACCACCATCTGCGAGAGTTTGAGCAACCGTGCTCGTGCATGATGATTTCAGGCATGACAC

Reverse complement sequence

GTGTCATGCCTGAAATCATCATGCACGAGCACGGTTGCTCAAACTCTCGCAGATGGTGGTATAGATTTTTCATGGTCAAGTCTGGAGAAGGATTGGTCCC[A/G]
AACCATGGCTATAAAGCTAGGGAGGAGTTCATAATTGTTGGTATTTCTTAACGACATTACTAGAAATATAATTCCCAGCAATGGCGCAGAAATACTTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 32.00% 0.11% 2.07% NA
All Indica  2759 53.40% 42.90% 0.14% 3.52% NA
All Japonica  1512 97.40% 2.60% 0.07% 0.00% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 60.80% 39.00% 0.17% 0.00% NA
Indica II  465 18.10% 78.90% 0.43% 2.58% NA
Indica III  913 71.90% 21.70% 0.00% 6.46% NA
Indica Intermediate  786 47.30% 49.20% 0.13% 3.31% NA
Temperate Japonica  767 95.40% 4.40% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 2.10% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 16.70% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716330932 T -> DEL N N silent_mutation Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0716330932 T -> C LOC_Os07g27980.1 upstream_gene_variant ; 3376.0bp to feature; MODIFIER silent_mutation Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0716330932 T -> C LOC_Os07g28000.1 upstream_gene_variant ; 2043.0bp to feature; MODIFIER silent_mutation Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N
vg0716330932 T -> C LOC_Os07g27980-LOC_Os07g28000 intergenic_region ; MODIFIER silent_mutation Average:42.104; most accessible tissue: Minghui63 flag leaf, score: 83.826 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716330932 NA 4.96E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932 NA 4.81E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932 2.70E-07 7.83E-08 mr1705 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932 NA 3.10E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716330932 4.50E-08 9.92E-13 mr1705_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251