\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716322335:

Variant ID: vg0716322335 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16322335
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAAATCTATGGCCTTGTTTAGTTTTAAACTTCTAACTTTTCCATCACATCAAAACTTTCCTACACACATAGACTTTCAACTTTTCCATCACATCGTT[T/C]
TAATTTTAACCAAACTTCCAATTTTAGCGTGAACTAAACACAACCTATATTGGTTTGCTGGTAGCGTTCTGCAGGCTGCTCCAGTCAATCCCAGCAATGC

Reverse complement sequence

GCATTGCTGGGATTGACTGGAGCAGCCTGCAGAACGCTACCAGCAAACCAATATAGGTTGTGTTTAGTTCACGCTAAAATTGGAAGTTTGGTTAAAATTA[A/G]
AACGATGTGATGGAAAAGTTGAAAGTCTATGTGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTAGAAGTTTAAAACTAAACAAGGCCATAGATTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.90% 18.00% 0.06% 0.00% NA
All Indica  2759 79.10% 20.80% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 6.30% 93.70% 0.00% 0.00% NA
Indica I  595 72.80% 26.90% 0.34% 0.00% NA
Indica II  465 88.40% 11.60% 0.00% 0.00% NA
Indica III  913 81.70% 18.30% 0.00% 0.00% NA
Indica Intermediate  786 75.40% 24.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 84.40% 15.60% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716322335 T -> C LOC_Os07g27970.1 upstream_gene_variant ; 3499.0bp to feature; MODIFIER silent_mutation Average:61.427; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0716322335 T -> C LOC_Os07g27980.1 downstream_gene_variant ; 2523.0bp to feature; MODIFIER silent_mutation Average:61.427; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg0716322335 T -> C LOC_Os07g27970-LOC_Os07g27980 intergenic_region ; MODIFIER silent_mutation Average:61.427; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716322335 NA 8.56E-15 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716322335 NA 1.53E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716322335 NA 2.97E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716322335 NA 3.62E-06 mr1705 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716322335 NA 1.92E-08 mr1847 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716322335 2.53E-06 2.26E-09 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251