\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716284413:

Variant ID: vg0716284413 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16284413
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 61. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGCGTGCCTGGAGTCGGAGCTGCCGCCGGCGCCGGTGCTGCTGTCTCTAGAGATGGCACGCCGGGAGCCAGAGCCATTGCGAGCGTCAACACCAACG[G/A]
AGGCAATTCTGCCTCACAATCCAGCGGAGGGCCATTCTCGGGGTATGTCCTTCTCCTGCTGTTAACTCATTCGTTCATACCGCTGTTAGTCGTGTTAGTC

Reverse complement sequence

GACTAACACGACTAACAGCGGTATGAACGAATGAGTTAACAGCAGGAGAAGGACATACCCCGAGAATGGCCCTCCGCTGGATTGTGAGGCAGAATTGCCT[C/T]
CGTTGGTGTTGACGCTCGCAATGGCTCTGGCTCCCGGCGTGCCATCTCTAGAGACAGCAGCACCGGCGCCGGCGGCAGCTCCGACTCCAGGCACGCCATC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.10% 0.21% 0.61% NA
All Indica  2759 95.80% 4.00% 0.18% 0.04% NA
All Japonica  1512 0.90% 98.90% 0.00% 0.13% NA
Aus  269 86.20% 6.70% 0.37% 6.69% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 90.10% 9.40% 0.38% 0.13% NA
Temperate Japonica  767 1.20% 98.80% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 97.90% 0.00% 0.83% NA
VI/Aromatic  96 4.20% 84.40% 3.12% 8.33% NA
Intermediate  90 48.90% 50.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716284413 G -> DEL LOC_Os07g27920.1 N frameshift_variant Average:41.87; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 N N N N
vg0716284413 G -> A LOC_Os07g27920.1 missense_variant ; p.Glu34Lys; MODERATE nonsynonymous_codon ; E34K Average:41.87; most accessible tissue: Zhenshan97 flag leaf, score: 57.42 unknown unknown DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716284413 NA 2.38E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 7.49E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 2.45E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.60E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 2.70E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 3.69E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.25E-56 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.16E-73 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.58E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 5.79E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.95E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 5.33E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 3.23E-54 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 3.38E-40 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 8.96E-09 7.94E-08 mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 5.56E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 4.12E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 6.56E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 2.84E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.02E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 5.67E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.12E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 4.73E-33 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716284413 NA 1.45E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251