\
| Variant ID: vg0716279747 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16279747 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.13, others allele: 0.00, population size: 173. )
AAGGTTCTAAGTGCCATACTTGTGTTCAATCGAAACAACCTCGCAAGCCTCACAAGGCATCTGAGGTGAGGAATTTGGCACCTCTAGAACTTGTTCATTC[C/T]
GATTTGTGCGAATGAACAGCGTGTTGACTAAAGGGGGAAAGAAATATTTCATGACACTGATAGATGATTGCACTAGATTTTGTTATGTGTATCTATTGAA
TTCAATAGATACACATAACAAAATCTAGTGCAATCATCTATCAGTGTCATGAAATATTTCTTTCCCCCTTTAGTCAACACGCTGTTCATTCGCACAAATC[G/A]
GAATGAACAAGTTCTAGAGGTGCCAAATTCCTCACCTCAGATGCCTTGTGAGGCTTGCGAGGTTGTTTCGATTGAACACAAGTATGGCACTTAGAACCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.20% | 37.00% | 0.83% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 4.20% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 1.60% | 98.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 85.90% | 6.70% | 7.43% | 0.00% | NA |
| Indica I | 595 | 97.80% | 1.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 95.70% | 4.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 90.30% | 9.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.60% | 99.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.60% | 94.60% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 84.40% | 11.46% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 52.20% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716279747 | C -> T | LOC_Os07g27890.1 | upstream_gene_variant ; 3356.0bp to feature; MODIFIER | silent_mutation | Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0716279747 | C -> T | LOC_Os07g27910.1 | upstream_gene_variant ; 2979.0bp to feature; MODIFIER | silent_mutation | Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0716279747 | C -> T | LOC_Os07g27920.1 | upstream_gene_variant ; 4567.0bp to feature; MODIFIER | silent_mutation | Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| vg0716279747 | C -> T | LOC_Os07g27900.1 | intron_variant ; MODIFIER | silent_mutation | Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716279747 | NA | 6.11E-36 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | NA | 9.72E-15 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | NA | 2.48E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | NA | 1.66E-13 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | NA | 1.66E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | 1.28E-06 | 1.28E-06 | mr1369_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | 7.58E-07 | 7.58E-07 | mr1453_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | NA | 8.02E-06 | mr1528_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716279747 | NA | 4.93E-08 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |