\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716279747:

Variant ID: vg0716279747 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16279747
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.13, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


AAGGTTCTAAGTGCCATACTTGTGTTCAATCGAAACAACCTCGCAAGCCTCACAAGGCATCTGAGGTGAGGAATTTGGCACCTCTAGAACTTGTTCATTC[C/T]
GATTTGTGCGAATGAACAGCGTGTTGACTAAAGGGGGAAAGAAATATTTCATGACACTGATAGATGATTGCACTAGATTTTGTTATGTGTATCTATTGAA

Reverse complement sequence

TTCAATAGATACACATAACAAAATCTAGTGCAATCATCTATCAGTGTCATGAAATATTTCTTTCCCCCTTTAGTCAACACGCTGTTCATTCGCACAAATC[G/A]
GAATGAACAAGTTCTAGAGGTGCCAAATTCCTCACCTCAGATGCCTTGTGAGGCTTGCGAGGTTGTTTCGATTGAACACAAGTATGGCACTTAGAACCTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.20% 37.00% 0.83% 0.00% NA
All Indica  2759 95.60% 4.20% 0.18% 0.00% NA
All Japonica  1512 1.60% 98.30% 0.13% 0.00% NA
Aus  269 85.90% 6.70% 7.43% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 95.70% 4.10% 0.22% 0.00% NA
Indica III  913 98.70% 1.20% 0.11% 0.00% NA
Indica Intermediate  786 90.30% 9.50% 0.13% 0.00% NA
Temperate Japonica  767 1.30% 98.70% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 94.60% 0.83% 0.00% NA
VI/Aromatic  96 4.20% 84.40% 11.46% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716279747 C -> T LOC_Os07g27890.1 upstream_gene_variant ; 3356.0bp to feature; MODIFIER silent_mutation Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0716279747 C -> T LOC_Os07g27910.1 upstream_gene_variant ; 2979.0bp to feature; MODIFIER silent_mutation Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0716279747 C -> T LOC_Os07g27920.1 upstream_gene_variant ; 4567.0bp to feature; MODIFIER silent_mutation Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N
vg0716279747 C -> T LOC_Os07g27900.1 intron_variant ; MODIFIER silent_mutation Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716279747 NA 6.11E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 NA 9.72E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 NA 2.48E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 NA 1.66E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 NA 1.66E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 1.28E-06 1.28E-06 mr1369_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 7.58E-07 7.58E-07 mr1453_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 NA 8.02E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747 NA 4.93E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251