Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716279747:

Variant ID: vg0716279747 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16279747
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.13, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:

AAGGTTCTAAGTGCCATACTTGTGTTCAATCGAAACAACCTCGCAAGCCTCACAAGGCATCTGAGGTGAGGAATTTGGCACCTCTAGAACTTGTTCATTC[C/T]
GATTTGTGCGAATGAACAGCGTGTTGACTAAAGGGGGAAAGAAATATTTCATGACACTGATAGATGATTGCACTAGATTTTGTTATGTGTATCTATTGAA

Reverse complement sequence

TTCAATAGATACACATAACAAAATCTAGTGCAATCATCTATCAGTGTCATGAAATATTTCTTTCCCCCTTTAGTCAACACGCTGTTCATTCGCACAAATC[G/A]
GAATGAACAAGTTCTAGAGGTGCCAAATTCCTCACCTCAGATGCCTTGTGAGGCTTGCGAGGTTGTTTCGATTGAACACAAGTATGGCACTTAGAACCTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.20%	37.00%	0.83%	0.00%	NA
All Indica	2759	95.60%	4.20%	0.18%	0.00%	NA
All Japonica	1512	1.60%	98.30%	0.13%	0.00%	NA
Aus	269	85.90%	6.70%	7.43%	0.00%	NA
Indica I	595	97.80%	1.80%	0.34%	0.00%	NA
Indica II	465	95.70%	4.10%	0.22%	0.00%	NA
Indica III	913	98.70%	1.20%	0.11%	0.00%	NA
Indica Intermediate	786	90.30%	9.50%	0.13%	0.00%	NA
Temperate Japonica	767	1.30%	98.70%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	4.60%	94.60%	0.83%	0.00%	NA
VI/Aromatic	96	4.20%	84.40%	11.46%	0.00%	NA
Intermediate	90	46.70%	52.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716279747	C -> T	LOC_Os07g27890.1	upstream_gene_variant ; 3356.0bp to feature; MODIFIER	silent_mutation	Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0716279747	C -> T	LOC_Os07g27910.1	upstream_gene_variant ; 2979.0bp to feature; MODIFIER	silent_mutation	Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0716279747	C -> T	LOC_Os07g27920.1	upstream_gene_variant ; 4567.0bp to feature; MODIFIER	silent_mutation	Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N
vg0716279747	C -> T	LOC_Os07g27900.1	intron_variant ; MODIFIER	silent_mutation	Average:18.681; most accessible tissue: Minghui63 flag leaf, score: 30.782	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716279747	NA	6.11E-36	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	NA	9.72E-15	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	NA	2.48E-12	mr1325_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	NA	1.66E-13	mr1326_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	NA	1.66E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	1.28E-06	1.28E-06	mr1369_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	7.58E-07	7.58E-07	mr1453_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	NA	8.02E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716279747	NA	4.93E-08	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251