Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716269579:

Variant ID: vg0716269579 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16269579
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.09, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:

AACGTAGACTAATAACAAAACAAATTACAGATTCCGACGATAAACTGGGAGACGAATCTTTTAAGCCTAATTAATCCATCATTAGTACATGTGGGTTACT[A/G]
TAGCACTTATGGCTAATCACGACGTAATTAGGCTCAAAAGATTCGTCTCGCGATTTACAGGTGGACTGTACAATTAGTTTTTCTTTTTGTCCATATTTGA

Reverse complement sequence

TCAAATATGGACAAAAAGAAAAACTAATTGTACAGTCCACCTGTAAATCGCGAGACGAATCTTTTGAGCCTAATTACGTCGTGATTAGCCATAAGTGCTA[T/C]
AGTAACCCACATGTACTAATGATGGATTAATTAGGCTTAAAAGATTCGTCTCCCAGTTTATCGTCGGAATCTGTAATTTGTTTTGTTATTAGTCTACGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.50%	39.10%	0.95%	11.43%	NA
All Indica	2759	72.90%	8.70%	1.49%	16.93%	NA
All Japonica	1512	2.60%	97.10%	0.07%	0.20%	NA
Aus	269	75.10%	6.30%	0.37%	18.22%	NA
Indica I	595	56.30%	1.30%	2.86%	39.50%	NA
Indica II	465	84.50%	6.50%	0.86%	8.17%	NA
Indica III	913	83.60%	11.50%	0.44%	4.49%	NA
Indica Intermediate	786	66.00%	12.50%	2.04%	19.47%	NA
Temperate Japonica	767	4.70%	95.20%	0.13%	0.00%	NA
Tropical Japonica	504	0.20%	99.60%	0.00%	0.20%	NA
Japonica Intermediate	241	1.20%	97.90%	0.00%	0.83%	NA
VI/Aromatic	96	3.10%	82.30%	0.00%	14.58%	NA
Intermediate	90	42.20%	47.80%	2.22%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716269579	A -> DEL	N	N	silent_mutation	Average:53.275; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0716269579	A -> G	LOC_Os07g27880.1	upstream_gene_variant ; 3427.0bp to feature; MODIFIER	silent_mutation	Average:53.275; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0716269579	A -> G	LOC_Os07g27870.1	downstream_gene_variant ; 2982.0bp to feature; MODIFIER	silent_mutation	Average:53.275; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0716269579	A -> G	LOC_Os07g27870-LOC_Os07g27880	intergenic_region ; MODIFIER	silent_mutation	Average:53.275; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716269579	NA	2.35E-12	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716269579	NA	9.98E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716269579	1.43E-07	6.14E-08	mr1265_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716269579	NA	1.58E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716269579	NA	8.82E-07	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251