Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716110434:

Variant ID: vg0716110434 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16110434
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CCGACCCATGGTTCGGTCGAACCCTCCTCAGCGCCGCTCGATCCAGGGTTGGTGATGGATGGTGTGGATGGCTTCCCTATAGCGATTGAAGGGTATTACC[A/G]
ACCTTTCCAACCGCCATAACCATCACTACCTGTCTGTAAAAGGCTCACTCTCTCTCCATTTCAAGACACACCTCAAACAAGAAGATCATTTCATCTCTCA

Reverse complement sequence

TGAGAGATGAAATGATCTTCTTGTTTGAGGTGTGTCTTGAAATGGAGAGAGAGTGAGCCTTTTACAGACAGGTAGTGATGGTTATGGCGGTTGGAAAGGT[T/C]
GGTAATACCCTTCAATCGCTATAGGGAAGCCATCCACACCATCCATCACCAACCCTGGATCGAGCGGCGCTGAGGAGGGTTCGACCGAACCATGGGTCGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	48.40%	0.08%	0.00%	NA
All Indica	2759	27.50%	72.40%	0.07%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	8.20%	91.80%	0.00%	0.00%	NA
Indica I	595	2.20%	97.60%	0.17%	0.00%	NA
Indica II	465	72.30%	27.50%	0.22%	0.00%	NA
Indica III	913	16.40%	83.60%	0.00%	0.00%	NA
Indica Intermediate	786	33.20%	66.80%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	63.30%	34.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716110434	A -> G	LOC_Os07g27570.1	upstream_gene_variant ; 3051.0bp to feature; MODIFIER	silent_mutation	Average:52.382; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg0716110434	A -> G	LOC_Os07g27590.1	upstream_gene_variant ; 1394.0bp to feature; MODIFIER	silent_mutation	Average:52.382; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg0716110434	A -> G	LOC_Os07g27580.1	downstream_gene_variant ; 1003.0bp to feature; MODIFIER	silent_mutation	Average:52.382; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N
vg0716110434	A -> G	LOC_Os07g27580-LOC_Os07g27590	intergenic_region ; MODIFIER	silent_mutation	Average:52.382; most accessible tissue: Zhenshan97 young leaf, score: 70.625	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716110434	NA	1.07E-12	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.55E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	8.00E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	7.01E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.16E-27	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	2.95E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.17E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	6.47E-17	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.43E-06	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	2.24E-07	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	6.15E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	5.58E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	5.49E-06	mr1942	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.35E-07	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	2.78E-38	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.82E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	3.00E-28	mr1077_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.02E-08	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	3.26E-29	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	5.36E-07	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	7.30E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.77E-31	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	3.80E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	2.76E-17	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	6.39E-10	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716110434	NA	1.53E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251