Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716104334:

Variant ID: vg0716104334 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16104334
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, C: 0.15, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCCCTTGCATTTATTCTGCACTTGTGGGTGTGTCTTGTTGAGTACGGTGGTTGTACTCAGTCTTGCTCAATTTTTCCCAAACCCAGAAGAGGAGTTCC[C/T]
GGAAGATGAAGGCTTTGGTGTCTAGCTGGTGCCTGCCGTCAAGCGCCTGTGGTCGTCGCCCTAGTCTTCTGCTGTTTTTCGTTTGTCTTCTTGTGTGCTG

Reverse complement sequence

CAGCACACAAGAAGACAAACGAAAAACAGCAGAAGACTAGGGCGACGACCACAGGCGCTTGACGGCAGGCACCAGCTAGACACCAAAGCCTTCATCTTCC[G/A]
GGAACTCCTCTTCTGGGTTTGGGAAAAATTGAGCAAGACTGAGTACAACCACCGTACTCAACAAGACACACCCACAAGTGCAGAATAAATGCAAGGGAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.30%	27.80%	2.01%	36.82%	NA
All Indica	2759	3.40%	37.50%	2.86%	56.22%	NA
All Japonica	1512	87.80%	11.50%	0.20%	0.46%	NA
Aus	269	8.60%	29.70%	3.35%	58.36%	NA
Indica I	595	1.30%	51.60%	2.18%	44.87%	NA
Indica II	465	6.00%	16.30%	1.94%	75.70%	NA
Indica III	913	1.50%	33.10%	2.08%	63.31%	NA
Indica Intermediate	786	5.50%	44.70%	4.83%	45.04%	NA
Temperate Japonica	767	78.00%	21.10%	0.39%	0.52%	NA
Tropical Japonica	504	98.20%	1.60%	0.00%	0.20%	NA
Japonica Intermediate	241	97.50%	1.70%	0.00%	0.83%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	48.90%	18.90%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716104334	C -> DEL	N	N	silent_mutation	Average:11.27; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0716104334	C -> T	LOC_Os07g27580.1	upstream_gene_variant ; 4339.0bp to feature; MODIFIER	silent_mutation	Average:11.27; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0716104334	C -> T	LOC_Os07g27550.1	downstream_gene_variant ; 3871.0bp to feature; MODIFIER	silent_mutation	Average:11.27; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0716104334	C -> T	LOC_Os07g27560.1	downstream_gene_variant ; 891.0bp to feature; MODIFIER	silent_mutation	Average:11.27; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0716104334	C -> T	LOC_Os07g27570.1	downstream_gene_variant ; 292.0bp to feature; MODIFIER	silent_mutation	Average:11.27; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0716104334	C -> T	LOC_Os07g27560-LOC_Os07g27570	intergenic_region ; MODIFIER	silent_mutation	Average:11.27; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716104334	NA	9.66E-18	mr1336_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251