Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0716096216:

Variant ID: vg0716096216 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 16096216
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGCAGGCCGATTCAGAGCAAATTGAAGTTCGCGAAGACTTGACCTATGTAGAGAAGCCGGTGAAGATTCTGGACAGCATGGAGCGCAGGACCAGGAAC[T/C]
GGGTAATCCGTTTTTGCAAGGTTCAATGGAGCAACCACGCCGAGGAAGAAGCTACTTGGGAACGTGAGGACGAGTTGAAGACAGCCCATCCCGATCTCTT

Reverse complement sequence

AAGAGATCGGGATGGGCTGTCTTCAACTCGTCCTCACGTTCCCAAGTAGCTTCTTCCTCGGCGTGGTTGCTCCATTGAACCTTGCAAAAACGGATTACCC[A/G]
GTTCCTGGTCCTGCGCTCCATGCTGTCCAGAATCTTCACCGGCTTCTCTACATAGGTCAAGTCTTCGCGAACTTCAATTTGCTCTGAATCGGCCTGCTCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.00%	18.20%	1.25%	56.54%	NA
All Indica	2759	8.40%	3.80%	1.78%	86.01%	NA
All Japonica	1512	51.70%	47.40%	0.26%	0.66%	NA
Aus	269	1.10%	8.20%	0.37%	90.33%	NA
Indica I	595	3.00%	0.70%	3.03%	93.28%	NA
Indica II	465	3.20%	2.60%	2.58%	91.61%	NA
Indica III	913	12.30%	0.70%	1.20%	85.87%	NA
Indica Intermediate	786	11.10%	10.60%	1.02%	77.35%	NA
Temperate Japonica	767	60.40%	38.90%	0.26%	0.52%	NA
Tropical Japonica	504	27.40%	72.00%	0.20%	0.40%	NA
Japonica Intermediate	241	75.10%	22.80%	0.41%	1.66%	NA
VI/Aromatic	96	91.70%	0.00%	0.00%	8.33%	NA
Intermediate	90	34.40%	17.80%	5.56%	42.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716096216	T -> DEL	N	N	silent_mutation	Average:6.875; most accessible tissue: Callus, score: 21.728	N	N	N	N
vg0716096216	T -> C	LOC_Os07g27530.1	upstream_gene_variant ; 4801.0bp to feature; MODIFIER	silent_mutation	Average:6.875; most accessible tissue: Callus, score: 21.728	N	N	N	N
vg0716096216	T -> C	LOC_Os07g27550.1	upstream_gene_variant ; 2360.0bp to feature; MODIFIER	silent_mutation	Average:6.875; most accessible tissue: Callus, score: 21.728	N	N	N	N
vg0716096216	T -> C	LOC_Os07g27540.1	downstream_gene_variant ; 334.0bp to feature; MODIFIER	silent_mutation	Average:6.875; most accessible tissue: Callus, score: 21.728	N	N	N	N
vg0716096216	T -> C	LOC_Os07g27540-LOC_Os07g27550	intergenic_region ; MODIFIER	silent_mutation	Average:6.875; most accessible tissue: Callus, score: 21.728	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716096216	1.16E-06	NA	mr1265	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	NA	8.35E-08	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	NA	5.02E-07	mr1528	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	NA	7.08E-07	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	4.81E-07	8.16E-08	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	2.08E-08	3.62E-09	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	NA	1.21E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	NA	5.28E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	3.47E-07	8.20E-08	mr1528_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716096216	4.61E-07	4.66E-08	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251