\
| Variant ID: vg0716089949 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16089949 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GATCTTCGGCTGGGGACGCCTAGAGCCGATAAGGCCTTGTCGGATCCTGTAGAGACGAAAGACCATGTAAGATCTGGTCGTGTAAGAGTTCTTGCCGTGC[G/A]
TATTAACCAAGCCGTGTAATCGGAAATTAACTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTGCTTGTAAAACCAAGGCAGGTCAAAGGTCCAAGAGC
GCTCTTGGACCTTTGACCTGCCTTGGTTTTACAAGCACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTTAATTTCCGATTACACGGCTTGGTTAATA[C/T]
GCACGGCAAGAACTCTTACACGACCAGATCTTACATGGTCTTTCGTCTCTACAGGATCCGACAAGGCCTTATCGGCTCTAGGCGTCCCCAGCCGAAGATC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.50% | 4.80% | 13.99% | 9.69% | NA |
| All Indica | 2759 | 60.40% | 1.90% | 21.49% | 16.24% | NA |
| All Japonica | 1512 | 88.00% | 11.50% | 0.20% | 0.26% | NA |
| Aus | 269 | 80.70% | 0.40% | 18.59% | 0.37% | NA |
| Indica I | 595 | 68.20% | 0.80% | 24.03% | 6.89% | NA |
| Indica II | 465 | 30.30% | 1.70% | 22.37% | 45.59% | NA |
| Indica III | 913 | 67.80% | 0.30% | 21.91% | 9.97% | NA |
| Indica Intermediate | 786 | 63.60% | 4.60% | 18.58% | 13.23% | NA |
| Temperate Japonica | 767 | 78.10% | 21.40% | 0.13% | 0.39% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 2.20% | 16.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716089949 | G -> DEL | N | N | silent_mutation | Average:7.996; most accessible tissue: Callus, score: 28.231 | N | N | N | N |
| vg0716089949 | G -> A | LOC_Os07g27540.1 | upstream_gene_variant ; 4697.0bp to feature; MODIFIER | silent_mutation | Average:7.996; most accessible tissue: Callus, score: 28.231 | N | N | N | N |
| vg0716089949 | G -> A | LOC_Os07g27520.1 | downstream_gene_variant ; 611.0bp to feature; MODIFIER | silent_mutation | Average:7.996; most accessible tissue: Callus, score: 28.231 | N | N | N | N |
| vg0716089949 | G -> A | LOC_Os07g27530.1 | downstream_gene_variant ; 365.0bp to feature; MODIFIER | silent_mutation | Average:7.996; most accessible tissue: Callus, score: 28.231 | N | N | N | N |
| vg0716089949 | G -> A | LOC_Os07g27520-LOC_Os07g27530 | intergenic_region ; MODIFIER | silent_mutation | Average:7.996; most accessible tissue: Callus, score: 28.231 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716089949 | 3.99E-11 | 7.41E-11 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716089949 | 1.76E-07 | 1.02E-08 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716089949 | 2.92E-10 | 3.48E-11 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716089949 | 1.31E-06 | 7.39E-08 | mr1528_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |