\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716089949:

Variant ID: vg0716089949 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16089949
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCTTCGGCTGGGGACGCCTAGAGCCGATAAGGCCTTGTCGGATCCTGTAGAGACGAAAGACCATGTAAGATCTGGTCGTGTAAGAGTTCTTGCCGTGC[G/A]
TATTAACCAAGCCGTGTAATCGGAAATTAACTTTCCAACTTCACGGCTGGGGGCTAGGATCAGTGCTTGTAAAACCAAGGCAGGTCAAAGGTCCAAGAGC

Reverse complement sequence

GCTCTTGGACCTTTGACCTGCCTTGGTTTTACAAGCACTGATCCTAGCCCCCAGCCGTGAAGTTGGAAAGTTAATTTCCGATTACACGGCTTGGTTAATA[C/T]
GCACGGCAAGAACTCTTACACGACCAGATCTTACATGGTCTTTCGTCTCTACAGGATCCGACAAGGCCTTATCGGCTCTAGGCGTCCCCAGCCGAAGATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 4.80% 13.99% 9.69% NA
All Indica  2759 60.40% 1.90% 21.49% 16.24% NA
All Japonica  1512 88.00% 11.50% 0.20% 0.26% NA
Aus  269 80.70% 0.40% 18.59% 0.37% NA
Indica I  595 68.20% 0.80% 24.03% 6.89% NA
Indica II  465 30.30% 1.70% 22.37% 45.59% NA
Indica III  913 67.80% 0.30% 21.91% 9.97% NA
Indica Intermediate  786 63.60% 4.60% 18.58% 13.23% NA
Temperate Japonica  767 78.10% 21.40% 0.13% 0.39% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.41% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 2.20% 16.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716089949 G -> DEL N N silent_mutation Average:7.996; most accessible tissue: Callus, score: 28.231 N N N N
vg0716089949 G -> A LOC_Os07g27540.1 upstream_gene_variant ; 4697.0bp to feature; MODIFIER silent_mutation Average:7.996; most accessible tissue: Callus, score: 28.231 N N N N
vg0716089949 G -> A LOC_Os07g27520.1 downstream_gene_variant ; 611.0bp to feature; MODIFIER silent_mutation Average:7.996; most accessible tissue: Callus, score: 28.231 N N N N
vg0716089949 G -> A LOC_Os07g27530.1 downstream_gene_variant ; 365.0bp to feature; MODIFIER silent_mutation Average:7.996; most accessible tissue: Callus, score: 28.231 N N N N
vg0716089949 G -> A LOC_Os07g27520-LOC_Os07g27530 intergenic_region ; MODIFIER silent_mutation Average:7.996; most accessible tissue: Callus, score: 28.231 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716089949 3.99E-11 7.41E-11 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716089949 1.76E-07 1.02E-08 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716089949 2.92E-10 3.48E-11 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716089949 1.31E-06 7.39E-08 mr1528_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251