Search for Variation information by Variation ID:
Detailed information for vg0716085095:
| Variant ID: vg0716085095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16085095 |
| Reference Allele: C | Alternative Allele: G,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )
Flanking Sequence (100 bp) in Reference Genome:
AACTGCATTGAAAGGCTCTGCGCATTCATGGCTGATGCATCTCCCGCCCTACTTGTTTTCTTCGTGGGCAGACCTGTGGCAGCAGTTCGTCGCCAACTTC[C/G,T]
AAGGAACTTACAAGCGCCACGCGATCGAAGACGACCTACATGTGTTGACACAGAACCCGGGTGAATCCTTGAGGGATTATGTTCGGCGCTTTAATGAGTG
Reverse complement sequence
CACTCATTAAAGCGCCGAACATAATCCCTCAAGGATTCACCCGGGTTCTGTGTCAACACATGTAGGTCGTCTTCGATCGCGTGGCGCTTGTAAGTTCCTT[G/C,A]
GAAGTTGGCGACGAACTGCTGCCACAGGTCTGCCCACGAAGAAAACAAGTAGGGCGGGAGATGCATCAGCCATGAATGCGCAGAGCCTTTCAATGCAGTT
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.30% | 4.70% | 5.61% | 29.33% | T: 0.02% |
| All Indica | 2759 | 45.10% | 1.70% | 8.59% | 44.55% | T: 0.04% |
| All Japonica | 1512 | 88.00% | 11.40% | 0.00% | 0.53% | NA |
| Aus | 269 | 43.90% | 0.00% | 8.18% | 47.96% | NA |
| Indica I | 595 | 58.70% | 0.80% | 10.76% | 29.75% | NA |
| Indica II | 465 | 25.20% | 1.10% | 6.24% | 67.53% | NA |
| Indica III | 913 | 40.10% | 0.20% | 10.41% | 49.18% | T: 0.11% |
| Indica Intermediate | 786 | 52.50% | 4.50% | 6.23% | 36.77% | NA |
| Temperate Japonica | 767 | 78.20% | 21.30% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 98.40% | 1.40% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 2.20% | 6.67% | 22.22% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716085095 | C -> DEL | LOC_Os07g27520.1 | N | frameshift_variant | Average:13.883; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
| vg0716085095 | C -> G | LOC_Os07g27520.1 | N | nonsynonymous_codon ; Q347E | Average:13.883; most accessible tissue: Zhenshan97 root, score: 16.934 | benign  |
0.23 |
DELETERIOUS | 0.01 |
| vg0716085095 | C -> T | LOC_Os07g27520.1 | stop_gained ; p.Gln347*; HIGH | stop_gained | Average:13.883; most accessible tissue: Zhenshan97 root, score: 16.934 | N | N | N | N |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716085095 | 7.04E-06 | NA | mr1265 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716085095 | 2.42E-06 | 3.70E-07 | mr1528 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716085095 | 6.77E-15 | 2.90E-14 | mr1265_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716085095 | 6.37E-06 | 6.37E-06 | mr1265_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716085095 | 3.64E-13 | 2.16E-14 | mr1528_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716085095 | 9.98E-08 | 9.98E-08 | mr1528_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |