\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716068649:

Variant ID: vg0716068649 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 16068649
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.01, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GCCTTCTCAAGATTCCAAATTTCCCAACTCAAACACAAAAACAAAACTAAAAGGAATCAGACTCTAATCCACCCAAATAAAATTAGAAGAGGGATCCACG[T/G]
TTGAATTCTAATCCATCGCAACATGAAACAATAAAAAAATATTCCACCTTGACTTCCCTTAGGCCTGACGGCTGCATGCATCGATGCAATCGCTCCCTCC

Reverse complement sequence

GGAGGGAGCGATTGCATCGATGCATGCAGCCGTCAGGCCTAAGGGAAGTCAAGGTGGAATATTTTTTTATTGTTTCATGTTGCGATGGATTAGAATTCAA[A/C]
CGTGGATCCCTCTTCTAATTTTATTTGGGTGGATTAGAGTCTGATTCCTTTTAGTTTTGTTTTTGTGTTTGAGTTGGGAAATTTGGAATCTTGAGAAGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.00% 36.90% 0.06% 0.00% NA
All Indica  2759 96.40% 3.50% 0.07% 0.00% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 91.60% 8.10% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 53.30% 45.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716068649 T -> G LOC_Os07g27500.1 downstream_gene_variant ; 879.0bp to feature; MODIFIER silent_mutation Average:54.452; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N
vg0716068649 T -> G LOC_Os07g27490-LOC_Os07g27500 intergenic_region ; MODIFIER silent_mutation Average:54.452; most accessible tissue: Zhenshan97 young leaf, score: 74.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716068649 NA 1.67E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 2.84E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 4.55E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 5.27E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 9.84E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 5.25E-69 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 7.86E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 1.45E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 1.70E-59 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 3.44E-76 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 1.91E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 2.12E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 5.68E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 6.40E-41 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 3.07E-42 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 7.14E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 4.24E-06 NA mr1977 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 2.72E-37 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 1.22E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 1.48E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 4.22E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 4.72E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 2.41E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716068649 NA 2.79E-31 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251