Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716066448:

Variant ID: vg0716066448 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 16066448
Reference Allele: CG	Alternative Allele: TG,C
Primary Allele: CG	Secondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGTGCCATACGGTAGGGGTGCTATGTACCTAGCCTTTGGGAGGAACTGGCGGCCTACCCTAGAAGTTATAGTAATTGTAAGTATATTTTGCCAATGCA[CG/TG,C]
GTGTGACATTTAAAAATATCTATTATCCTCTCTTCTCTCTCCCCTACCCCCACACACAAAGAAAGAAACAAAAAGGAAAATTGAATATCCGTCTAGCAAT

Reverse complement sequence

ATTGCTAGACGGATATTCAATTTTCCTTTTTGTTTCTTTCTTTGTGTGTGGGGGTAGGGGAGAGAGAAGAGAGGATAATAGATATTTTTAAATGTCACAC[CG/CA,G]
TGCATTGGCAAAATATACTTACAATTACTATAACTTCTAGGGTAGGCCGCCAGTTCCTCCCAAAGGCTAGGTACATAGCACCCCTACCGTATGGCACCAC

Allele Frequencies:

Populations	Population Size	Frequency of CG(primary allele)	Frequency of TG(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.40%	37.20%	0.38%	3.60%	C: 16.48%
All Indica	2759	5.60%	62.10%	0.62%	5.91%	C: 25.81%
All Japonica	1512	99.50%	0.50%	0.00%	0.00%	NA
Aus	269	76.60%	0.40%	0.00%	1.86%	C: 21.19%
Indica I	595	1.50%	58.80%	0.17%	0.17%	C: 39.33%
Indica II	465	4.50%	77.40%	0.43%	5.16%	C: 12.47%
Indica III	913	1.30%	67.70%	0.88%	9.75%	C: 20.37%
Indica Intermediate	786	14.40%	48.90%	0.76%	6.23%	C: 29.77%
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	0.00%	C: 3.12%
Intermediate	90	50.00%	38.90%	1.11%	2.22%	C: 7.78%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0716066448	CG -> DEL	N	N	silent_mutation	Average:40.702; most accessible tissue: Callus, score: 63.725	N	N	N	N
vg0716066448	CG -> TG	LOC_Os07g27500.1	downstream_gene_variant ; 3080.0bp to feature; MODIFIER	silent_mutation	Average:40.702; most accessible tissue: Callus, score: 63.725	N	N	N	N
vg0716066448	CG -> TG	LOC_Os07g27490-LOC_Os07g27500	intergenic_region ; MODIFIER	silent_mutation	Average:40.702; most accessible tissue: Callus, score: 63.725	N	N	N	N
vg0716066448	CG -> C	LOC_Os07g27500.1	downstream_gene_variant ; 3079.0bp to feature; MODIFIER	silent_mutation	Average:40.702; most accessible tissue: Callus, score: 63.725	N	N	N	N
vg0716066448	CG -> C	LOC_Os07g27490-LOC_Os07g27500	intergenic_region ; MODIFIER	silent_mutation	Average:40.702; most accessible tissue: Callus, score: 63.725	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0716066448	NA	3.42E-10	mr1316	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448	NA	5.68E-06	mr1468	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448	7.87E-06	4.58E-08	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448	7.83E-07	1.21E-09	mr1705	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448	NA	7.55E-07	mr1705_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251