\
| Variant ID: vg0716066448 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr07 | Position: 16066448 |
| Reference Allele: CG | Alternative Allele: TG,C |
| Primary Allele: CG | Secondary Allele: TG |
Inferred Ancestral Allele: Not determined.
GTGGTGCCATACGGTAGGGGTGCTATGTACCTAGCCTTTGGGAGGAACTGGCGGCCTACCCTAGAAGTTATAGTAATTGTAAGTATATTTTGCCAATGCA[CG/TG,C]
GTGTGACATTTAAAAATATCTATTATCCTCTCTTCTCTCTCCCCTACCCCCACACACAAAGAAAGAAACAAAAAGGAAAATTGAATATCCGTCTAGCAAT
ATTGCTAGACGGATATTCAATTTTCCTTTTTGTTTCTTTCTTTGTGTGTGGGGGTAGGGGAGAGAGAAGAGAGGATAATAGATATTTTTAAATGTCACAC[CG/CA,G]
TGCATTGGCAAAATATACTTACAATTACTATAACTTCTAGGGTAGGCCGCCAGTTCCTCCCAAAGGCTAGGTACATAGCACCCCTACCGTATGGCACCAC
| Populations | Population Size | Frequency of CG(primary allele) | Frequency of TG(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.40% | 37.20% | 0.38% | 3.60% | C: 16.48% |
| All Indica | 2759 | 5.60% | 62.10% | 0.62% | 5.91% | C: 25.81% |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 76.60% | 0.40% | 0.00% | 1.86% | C: 21.19% |
| Indica I | 595 | 1.50% | 58.80% | 0.17% | 0.17% | C: 39.33% |
| Indica II | 465 | 4.50% | 77.40% | 0.43% | 5.16% | C: 12.47% |
| Indica III | 913 | 1.30% | 67.70% | 0.88% | 9.75% | C: 20.37% |
| Indica Intermediate | 786 | 14.40% | 48.90% | 0.76% | 6.23% | C: 29.77% |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 0.00% | C: 3.12% |
| Intermediate | 90 | 50.00% | 38.90% | 1.11% | 2.22% | C: 7.78% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716066448 | CG -> DEL | N | N | silent_mutation | Average:40.702; most accessible tissue: Callus, score: 63.725 | N | N | N | N |
| vg0716066448 | CG -> TG | LOC_Os07g27500.1 | downstream_gene_variant ; 3080.0bp to feature; MODIFIER | silent_mutation | Average:40.702; most accessible tissue: Callus, score: 63.725 | N | N | N | N |
| vg0716066448 | CG -> TG | LOC_Os07g27490-LOC_Os07g27500 | intergenic_region ; MODIFIER | silent_mutation | Average:40.702; most accessible tissue: Callus, score: 63.725 | N | N | N | N |
| vg0716066448 | CG -> C | LOC_Os07g27500.1 | downstream_gene_variant ; 3079.0bp to feature; MODIFIER | silent_mutation | Average:40.702; most accessible tissue: Callus, score: 63.725 | N | N | N | N |
| vg0716066448 | CG -> C | LOC_Os07g27490-LOC_Os07g27500 | intergenic_region ; MODIFIER | silent_mutation | Average:40.702; most accessible tissue: Callus, score: 63.725 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716066448 | NA | 3.42E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716066448 | NA | 5.68E-06 | mr1468 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716066448 | 7.87E-06 | 4.58E-08 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716066448 | 7.83E-07 | 1.21E-09 | mr1705 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716066448 | NA | 7.55E-07 | mr1705_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |