\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0716066448:

Variant ID: vg0716066448 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 16066448
Reference Allele: CGAlternative Allele: TG,C
Primary Allele: CGSecondary Allele: TG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGGTGCCATACGGTAGGGGTGCTATGTACCTAGCCTTTGGGAGGAACTGGCGGCCTACCCTAGAAGTTATAGTAATTGTAAGTATATTTTGCCAATGCA[CG/TG,C]
GTGTGACATTTAAAAATATCTATTATCCTCTCTTCTCTCTCCCCTACCCCCACACACAAAGAAAGAAACAAAAAGGAAAATTGAATATCCGTCTAGCAAT

Reverse complement sequence

ATTGCTAGACGGATATTCAATTTTCCTTTTTGTTTCTTTCTTTGTGTGTGGGGGTAGGGGAGAGAGAAGAGAGGATAATAGATATTTTTAAATGTCACAC[CG/CA,G]
TGCATTGGCAAAATATACTTACAATTACTATAACTTCTAGGGTAGGCCGCCAGTTCCTCCCAAAGGCTAGGTACATAGCACCCCTACCGTATGGCACCAC

Allele Frequencies:

Populations Population SizeFrequency of CG(primary allele) Frequency of TG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.40% 37.20% 0.38% 3.60% C: 16.48%
All Indica  2759 5.60% 62.10% 0.62% 5.91% C: 25.81%
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 76.60% 0.40% 0.00% 1.86% C: 21.19%
Indica I  595 1.50% 58.80% 0.17% 0.17% C: 39.33%
Indica II  465 4.50% 77.40% 0.43% 5.16% C: 12.47%
Indica III  913 1.30% 67.70% 0.88% 9.75% C: 20.37%
Indica Intermediate  786 14.40% 48.90% 0.76% 6.23% C: 29.77%
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 0.00% C: 3.12%
Intermediate  90 50.00% 38.90% 1.11% 2.22% C: 7.78%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0716066448 CG -> DEL N N silent_mutation Average:40.702; most accessible tissue: Callus, score: 63.725 N N N N
vg0716066448 CG -> TG LOC_Os07g27500.1 downstream_gene_variant ; 3080.0bp to feature; MODIFIER silent_mutation Average:40.702; most accessible tissue: Callus, score: 63.725 N N N N
vg0716066448 CG -> TG LOC_Os07g27490-LOC_Os07g27500 intergenic_region ; MODIFIER silent_mutation Average:40.702; most accessible tissue: Callus, score: 63.725 N N N N
vg0716066448 CG -> C LOC_Os07g27500.1 downstream_gene_variant ; 3079.0bp to feature; MODIFIER silent_mutation Average:40.702; most accessible tissue: Callus, score: 63.725 N N N N
vg0716066448 CG -> C LOC_Os07g27490-LOC_Os07g27500 intergenic_region ; MODIFIER silent_mutation Average:40.702; most accessible tissue: Callus, score: 63.725 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0716066448 NA 3.42E-10 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448 NA 5.68E-06 mr1468 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448 7.87E-06 4.58E-08 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448 7.83E-07 1.21E-09 mr1705 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0716066448 NA 7.55E-07 mr1705_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251