\
| Variant ID: vg0716064209 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 16064209 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTCGCGCGGGCTACCTTCCTAGTTTTAATAATAGACCTCCCAGGAACTTATTTCTAAAATGAACCCTTTCGCCACACCATGGTAACCGGCGTGGCCAAT[C/T]
TGAGCTACCGCGCCATTGGTCATGGTGTCGCAAATTAAAGGGTGCCCCGTGGCAGTCGTTGCCATTGACAAGGTTAATTAGTCCCTGACGTGGCACAACT
AGTTGTGCCACGTCAGGGACTAATTAACCTTGTCAATGGCAACGACTGCCACGGGGCACCCTTTAATTTGCGACACCATGACCAATGGCGCGGTAGCTCA[G/A]
ATTGGCCACGCCGGTTACCATGGTGTGGCGAAAGGGTTCATTTTAGAAATAAGTTCCTGGGAGGTCTATTATTAAAACTAGGAAGGTAGCCCGCGCGAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.90% | 11.50% | 0.59% | 0.00% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 66.00% | 32.50% | 1.46% | 0.00% | NA |
| Aus | 269 | 92.60% | 6.30% | 1.12% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 85.40% | 13.60% | 1.04% | 0.00% | NA |
| Tropical Japonica | 504 | 30.80% | 67.30% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 20.30% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 12.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0716064209 | C -> T | LOC_Os07g27490-LOC_Os07g27500 | intergenic_region ; MODIFIER | silent_mutation | Average:54.194; most accessible tissue: Zhenshan97 young leaf, score: 65.804 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0716064209 | 2.68E-07 | 8.66E-09 | mr1321 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 2.40E-07 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 1.75E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 1.52E-10 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 4.57E-07 | mr1697 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 1.23E-06 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | 9.52E-07 | NA | mr1844 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | 1.49E-07 | NA | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 4.20E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 3.53E-12 | mr1905 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0716064209 | NA | 2.28E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |