\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715939840:

Variant ID: vg0715939840 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15939840
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTAGGATAGCATATCGGCTAGGCTCTATATTTTATGTGGAGGCTCTCGTGGTTTGGATGATAGGAAATATACAAGATAGTTGATATGGTTAAATAGG[T/C]
ATGTGGCTAATATGGGTCAAGGTTAGCTTTGATAGAATAGTGGCTAGGATTTAGTTGTTTAGGCCGATATCGAGGTAGGATAAATATCGGCTAGGGTTTT

Reverse complement sequence

AAAACCCTAGCCGATATTTATCCTACCTCGATATCGGCCTAAACAACTAAATCCTAGCCACTATTCTATCAAAGCTAACCTTGACCCATATTAGCCACAT[A/G]
CCTATTTAACCATATCAACTATCTTGTATATTTCCTATCATCCAAACCACGAGAGCCTCCACATAAAATATAGAGCCTAGCCGATATGCTATCCTACTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.70% 1.70% 8.97% 40.65% NA
All Indica  2759 14.20% 2.80% 15.22% 67.81% NA
All Japonica  1512 99.30% 0.00% 0.07% 0.66% NA
Aus  269 98.10% 0.40% 0.00% 1.49% NA
Indica I  595 5.70% 2.00% 7.73% 84.54% NA
Indica II  465 11.60% 2.40% 9.46% 76.56% NA
Indica III  913 10.10% 3.80% 26.73% 59.36% NA
Indica Intermediate  786 26.80% 2.40% 10.94% 59.80% NA
Temperate Japonica  767 99.10% 0.00% 0.13% 0.78% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 96.90% 0.00% 1.04% 2.08% NA
Intermediate  90 60.00% 0.00% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715939840 T -> DEL N N silent_mutation Average:8.482; most accessible tissue: Callus, score: 28.352 N N N N
vg0715939840 T -> C LOC_Os07g27390.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:8.482; most accessible tissue: Callus, score: 28.352 N N N N
vg0715939840 T -> C LOC_Os07g27390.1 5_prime_UTR_variant ; 546.0bp to feature; MODIFIER silent_mutation Average:8.482; most accessible tissue: Callus, score: 28.352 N N N N
vg0715939840 T -> C LOC_Os07g27380.1 downstream_gene_variant ; 4304.0bp to feature; MODIFIER silent_mutation Average:8.482; most accessible tissue: Callus, score: 28.352 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715939840 NA 1.30E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 7.57E-13 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 1.13E-06 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 7.36E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 6.51E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 2.53E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 1.73E-06 1.73E-06 mr1429 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 1.07E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 3.48E-12 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 3.35E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 3.41E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 1.92E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 1.51E-07 mr1666 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 2.27E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 4.00E-07 mr1717 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 2.56E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 1.70E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 8.21E-06 8.21E-06 mr1777 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 3.55E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 2.03E-06 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715939840 NA 4.83E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251