\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715893635:

Variant ID: vg0715893635 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15893635
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAATAATCAAGATGGGATTTGCCCCTCCTATGGAGAGATATCTCTGGGCTCCTCGATGATGTAGATTATGGAAGTGCATGGCCATGCCAAAGGTGATT[G/A]
AGGAGTCAATCACAAGTTATATAATCTATCAACATGTTCGAGCGAATGATTGAGCTATTAGAGAATGGCACATATCTAGCCTTGAGCTTAATCGATATTG

Reverse complement sequence

CAATATCGATTAAGCTCAAGGCTAGATATGTGCCATTCTCTAATAGCTCAATCATTCGCTCGAACATGTTGATAGATTATATAACTTGTGATTGACTCCT[C/T]
AATCACCTTTGGCATGGCCATGCACTTCCATAATCTACATCATCGAGGAGCCCAGAGATATCTCTCCATAGGAGGGGCAAATCCCATCTTGATTATTCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.10% 0.19% 0.00% NA
All Indica  2759 91.30% 8.40% 0.29% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 98.00% 1.30% 0.67% 0.00% NA
Indica II  465 95.10% 4.70% 0.22% 0.00% NA
Indica III  913 89.80% 10.10% 0.11% 0.00% NA
Indica Intermediate  786 85.60% 14.10% 0.25% 0.00% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715893635 G -> A LOC_Os07g27320.1 downstream_gene_variant ; 3603.0bp to feature; MODIFIER silent_mutation Average:21.531; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N
vg0715893635 G -> A LOC_Os07g27320-LOC_Os07g27330 intergenic_region ; MODIFIER silent_mutation Average:21.531; most accessible tissue: Zhenshan97 root, score: 34.536 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715893635 NA 1.52E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 3.58E-31 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 2.98E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.84E-25 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 2.09E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 5.08E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 8.88E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 2.21E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 5.91E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.47E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 6.32E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 6.64E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 2.23E-53 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.68E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.14E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 4.46E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 6.05E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.48E-56 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.08E-40 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 1.28E-07 4.45E-08 mr1155_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.09E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715893635 NA 1.04E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251