\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715892828:

Variant ID: vg0715892828 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15892828
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCCGGTTCAAAGCCGCGTTTGACCGCGGTCTTGCCTACGTGGCACGCGACGTGAACGATGACATGAAATTTTTTTATTTTTTTCTCTCTTCACCACTG[T/C]
GACAGCCCCTCACCTCGTGCTGCCTCTCACCACCGAGAAAAAAGAAGGAAGAAAGAGAAAAAAGAAGGAAGAAGCGAGAAAAAATATAAAAAAATTCTAT

Reverse complement sequence

ATAGAATTTTTTTATATTTTTTCTCGCTTCTTCCTTCTTTTTTCTCTTTCTTCCTTCTTTTTTCTCGGTGGTGAGAGGCAGCACGAGGTGAGGGGCTGTC[A/G]
CAGTGGTGAAGAGAGAAAAAAATAAAAAAATTTCATGTCATCGTTCACGTCGCGTGCCACGTAGGCAAGACCGCGGTCAAACGCGGCTTTGAACCGGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 12.30% 0.38% 0.00% NA
All Indica  2759 97.80% 2.00% 0.25% 0.00% NA
All Japonica  1512 65.30% 34.10% 0.66% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 2.70% 0.76% 0.00% NA
Temperate Japonica  767 36.90% 62.30% 0.78% 0.00% NA
Tropical Japonica  504 97.60% 1.80% 0.60% 0.00% NA
Japonica Intermediate  241 88.00% 11.60% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715892828 T -> C LOC_Os07g27320.1 downstream_gene_variant ; 2796.0bp to feature; MODIFIER silent_mutation Average:44.453; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0715892828 T -> C LOC_Os07g27320-LOC_Os07g27330 intergenic_region ; MODIFIER silent_mutation Average:44.453; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715892828 NA 1.73E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0715892828 NA 5.31E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 8.29E-06 mr1171 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 2.44E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 2.44E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 1.85E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 2.29E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 4.17E-06 mr1332 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 7.58E-06 mr1338 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 1.57E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 1.11E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 5.32E-14 mr1712 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 6.66E-10 mr1790 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 4.22E-09 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 6.31E-10 mr1880 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 8.75E-06 8.04E-11 mr1977 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 7.37E-08 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 4.33E-07 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715892828 NA 8.85E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251