\
| Variant ID: vg0715892828 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15892828 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATCCCGGTTCAAAGCCGCGTTTGACCGCGGTCTTGCCTACGTGGCACGCGACGTGAACGATGACATGAAATTTTTTTATTTTTTTCTCTCTTCACCACTG[T/C]
GACAGCCCCTCACCTCGTGCTGCCTCTCACCACCGAGAAAAAAGAAGGAAGAAAGAGAAAAAAGAAGGAAGAAGCGAGAAAAAATATAAAAAAATTCTAT
ATAGAATTTTTTTATATTTTTTCTCGCTTCTTCCTTCTTTTTTCTCTTTCTTCCTTCTTTTTTCTCGGTGGTGAGAGGCAGCACGAGGTGAGGGGCTGTC[A/G]
CAGTGGTGAAGAGAGAAAAAAATAAAAAAATTTCATGTCATCGTTCACGTCGCGTGCCACGTAGGCAAGACCGCGGTCAAACGCGGCTTTGAACCGGGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.30% | 12.30% | 0.38% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 2.00% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 65.30% | 34.10% | 0.66% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.70% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 36.90% | 62.30% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 97.60% | 1.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 11.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715892828 | T -> C | LOC_Os07g27320.1 | downstream_gene_variant ; 2796.0bp to feature; MODIFIER | silent_mutation | Average:44.453; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0715892828 | T -> C | LOC_Os07g27320-LOC_Os07g27330 | intergenic_region ; MODIFIER | silent_mutation | Average:44.453; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715892828 | NA | 1.73E-13 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0715892828 | NA | 5.31E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 8.29E-06 | mr1171 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 2.44E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 2.44E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 1.85E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 2.29E-07 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 4.17E-06 | mr1332 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 7.58E-06 | mr1338 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 1.57E-06 | mr1570 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 1.11E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 5.32E-14 | mr1712 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 6.66E-10 | mr1790 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 4.22E-09 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 6.31E-10 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | 8.75E-06 | 8.04E-11 | mr1977 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 7.37E-08 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 4.33E-07 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715892828 | NA | 8.85E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |