\
| Variant ID: vg0715863395 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15863395 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAGTACTAGTTCCCAAGATTACAGCGCAAACATTTCCAGTTTCTTTCTATATTGACGATCATCCTTTTTTTTTCTCCCATCTCTTGCAATCGATTATCCT[T/C]
CCGCCATCACCTCTCTCTTTTTTTTTGGCGTTTGCCTGTTCGGCAAGAGATATTAGTAATACACACTTAGAGCCTATTTGATTCCCCTATCAAAATTTTA
TAAAATTTTGATAGGGGAATCAAATAGGCTCTAAGTGTGTATTACTAATATCTCTTGCCGAACAGGCAAACGCCAAAAAAAAAGAGAGAGGTGATGGCGG[A/G]
AGGATAATCGATTGCAAGAGATGGGAGAAAAAAAAAGGATGATCGTCAATATAGAAAGAAACTGGAAATGTTTGCGCTGTAATCTTGGGAACTAGTACTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.10% | 0.87% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.50% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 80.50% | 17.80% | 1.72% | 0.00% | NA |
| Aus | 269 | 97.40% | 0.00% | 2.60% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.60% | 2.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 0.50% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 64.00% | 32.70% | 3.26% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715863395 | T -> C | LOC_Os07g27290.1 | downstream_gene_variant ; 424.0bp to feature; MODIFIER | silent_mutation | Average:36.932; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| vg0715863395 | T -> C | LOC_Os07g27290-LOC_Os07g27300 | intergenic_region ; MODIFIER | silent_mutation | Average:36.932; most accessible tissue: Zhenshan97 root, score: 59.664 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715863395 | NA | 3.45E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863395 | NA | 9.16E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863395 | NA | 5.43E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863395 | NA | 3.06E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863395 | 1.40E-06 | 2.98E-06 | mr1321_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863395 | NA | 3.06E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715863395 | NA | 5.25E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |