\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715863001:

Variant ID: vg0715863001 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15863001
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGGCGAGGCGGTCAGACCGGTGGCGGCGACAGCGACTTCAGACGCGGCAGACGATCTTCAGGCGGTTGAACCGAGTGATCAACACCGGTCAGACCGGC[G/A]
GCACGAGCGCGGTCAGACCGACGGATCAACTTCGGTCAGACCGCTATCCATCGAATTCGAGGGTAACTTTTATTTCCGCTAAAAGTTTTTGGTTTTTGGG

Reverse complement sequence

CCCAAAAACCAAAAACTTTTAGCGGAAATAAAAGTTACCCTCGAATTCGATGGATAGCGGTCTGACCGAAGTTGATCCGTCGGTCTGACCGCGCTCGTGC[C/T]
GCCGGTCTGACCGGTGTTGATCACTCGGTTCAACCGCCTGAAGATCGTCTGCCGCGTCTGAAGTCGCTGTCGCCGCCACCGGTCTGACCGCCTCGCCTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.80% 0.34% 0.00% NA
All Indica  2759 91.70% 8.00% 0.33% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 97.40% 0.00% 2.60% 0.00% NA
Indica I  595 84.40% 15.50% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 93.00% 6.90% 0.11% 0.00% NA
Indica Intermediate  786 91.50% 7.80% 0.76% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715863001 G -> A LOC_Os07g27290.1 downstream_gene_variant ; 30.0bp to feature; MODIFIER silent_mutation Average:50.171; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N
vg0715863001 G -> A LOC_Os07g27290-LOC_Os07g27300 intergenic_region ; MODIFIER silent_mutation Average:50.171; most accessible tissue: Zhenshan97 root, score: 61.518 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715863001 NA 1.57E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 4.92E-07 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 2.35E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 5.88E-06 NA mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 6.02E-07 6.12E-13 mr1059 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 4.90E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 1.09E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 8.52E-06 9.51E-12 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 5.40E-06 NA mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 6.02E-07 1.84E-13 mr1675 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 4.72E-10 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 2.47E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 3.83E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715863001 NA 5.14E-07 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251