\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715859839:

Variant ID: vg0715859839 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15859839
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ACATGACATTGTAAAAGAATGCAACATTTAATAGAAATGCGGGATATTTGTAAATTGGGTATAATATGATCAAATGTAATGCATGACTTGCCTTGCTCTC[G/A]
CACTGATGAGACCTCAGCAACGTCTTCGAAGAACCGCGGCTCGACGAAACAGCCGAAATCTAAGCGACAAACAAAGCACACAAGAAAAACATGCTATAAG

Reverse complement sequence

CTTATAGCATGTTTTTCTTGTGTGCTTTGTTTGTCGCTTAGATTTCGGCTGTTTCGTCGAGCCGCGGTTCTTCGAAGACGTTGCTGAGGTCTCATCAGTG[C/T]
GAGAGCAAGGCAAGTCATGCATTACATTTGATCATATTATACCCAATTTACAAATATCCCGCATTTCTATTAAATGTTGCATTCTTTTACAATGTCATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.80% 0.06% 0.00% NA
All Indica  2759 36.70% 63.20% 0.11% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 20.00% 79.70% 0.34% 0.00% NA
Indica II  465 11.60% 88.40% 0.00% 0.00% NA
Indica III  913 52.70% 47.20% 0.11% 0.00% NA
Indica Intermediate  786 45.50% 54.50% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715859839 G -> A LOC_Os07g27290.1 upstream_gene_variant ; 407.0bp to feature; MODIFIER silent_mutation Average:29.315; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N
vg0715859839 G -> A LOC_Os07g27280-LOC_Os07g27290 intergenic_region ; MODIFIER silent_mutation Average:29.315; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715859839 NA 1.62E-07 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 2.78E-07 mr1279 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 4.15E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 4.70E-11 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 6.47E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 7.50E-06 mr1468 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 4.77E-10 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 7.28E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 1.72E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 1.48E-06 1.48E-06 mr1572 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 5.96E-17 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 6.00E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 4.34E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 1.15E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 7.51E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 3.12E-29 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 1.49E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 3.79E-23 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 5.57E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715859839 NA 3.87E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251