\
| Variant ID: vg0715859839 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15859839 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 218. )
ACATGACATTGTAAAAGAATGCAACATTTAATAGAAATGCGGGATATTTGTAAATTGGGTATAATATGATCAAATGTAATGCATGACTTGCCTTGCTCTC[G/A]
CACTGATGAGACCTCAGCAACGTCTTCGAAGAACCGCGGCTCGACGAAACAGCCGAAATCTAAGCGACAAACAAAGCACACAAGAAAAACATGCTATAAG
CTTATAGCATGTTTTTCTTGTGTGCTTTGTTTGTCGCTTAGATTTCGGCTGTTTCGTCGAGCCGCGGTTCTTCGAAGACGTTGCTGAGGTCTCATCAGTG[C/T]
GAGAGCAAGGCAAGTCATGCATTACATTTGATCATATTATACCCAATTTACAAATATCCCGCATTTCTATTAAATGTTGCATTCTTTTACAATGTCATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 37.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 36.70% | 63.20% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 20.00% | 79.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 11.60% | 88.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.70% | 47.20% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 45.50% | 54.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715859839 | G -> A | LOC_Os07g27290.1 | upstream_gene_variant ; 407.0bp to feature; MODIFIER | silent_mutation | Average:29.315; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | N | N | N | N |
| vg0715859839 | G -> A | LOC_Os07g27280-LOC_Os07g27290 | intergenic_region ; MODIFIER | silent_mutation | Average:29.315; most accessible tissue: Zhenshan97 flag leaf, score: 42.807 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715859839 | NA | 1.62E-07 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 2.78E-07 | mr1279 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 4.15E-10 | mr1379 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 4.70E-11 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 6.47E-09 | mr1465 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 7.50E-06 | mr1468 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 4.77E-10 | mr1524 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 7.28E-42 | mr1526 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 1.72E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | 1.48E-06 | 1.48E-06 | mr1572 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 5.96E-17 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 6.00E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 4.34E-17 | mr1457_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 1.15E-07 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 7.51E-06 | mr1580_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 3.12E-29 | mr1825_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 1.49E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 3.79E-23 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 5.57E-07 | mr1870_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715859839 | NA | 3.87E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |