| Variant ID: vg0715857906 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15857906 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 108. )
CACAATTGCTATGAAACAAAGCCCGAATCATGCACCAGCCAAACCAGCTTTGTATGTATCTTCACGAGTTGACATAAGCCGAATCGAGCCGAGCTAACTC[G/A]
ATATCCATATCTAGGTGGCATCCTGTAGTGGCCGATCCCAAGAAAAACATATTATGAAAGTTTTTTTTAGAAGTTCTCAAAAACATTCTAAAGAAAATCG
CGATTTTCTTTAGAATGTTTTTGAGAACTTCTAAAAAAAACTTTCATAATATGTTTTTCTTGGGATCGGCCACTACAGGATGCCACCTAGATATGGATAT[C/T]
GAGTTAGCTCGGCTCGATTCGGCTTATGTCAACTCGTGAAGATACATACAAAGCTGGTTTGGCTGGTGCATGATTCGGGCTTTGTTTCATAGCAATTGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.00% | 33.50% | 0.38% | 0.15% | NA |
| All Indica | 2759 | 43.50% | 55.90% | 0.40% | 0.25% | NA |
| All Japonica | 1512 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 0.00% | 2.60% | 0.00% | NA |
| Indica I | 595 | 35.60% | 64.00% | 0.00% | 0.34% | NA |
| Indica II | 465 | 12.30% | 87.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 56.70% | 42.50% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 52.40% | 46.60% | 0.76% | 0.25% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715857906 | G -> DEL | N | N | silent_mutation | Average:42.152; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| vg0715857906 | G -> A | LOC_Os07g27290.1 | upstream_gene_variant ; 2340.0bp to feature; MODIFIER | silent_mutation | Average:42.152; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| vg0715857906 | G -> A | LOC_Os07g27280.1 | downstream_gene_variant ; 3379.0bp to feature; MODIFIER | silent_mutation | Average:42.152; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| vg0715857906 | G -> A | LOC_Os07g27280-LOC_Os07g27290 | intergenic_region ; MODIFIER | silent_mutation | Average:42.152; most accessible tissue: Zhenshan97 young leaf, score: 64.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715857906 | NA | 4.51E-19 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0715857906 | NA | 3.20E-14 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0715857906 | NA | 3.91E-09 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 1.28E-10 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 1.15E-09 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 8.22E-13 | mr1169 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 6.10E-07 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 2.63E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 3.51E-07 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715857906 | NA | 1.09E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/