\
| Variant ID: vg0715840651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15840651 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 72. )
TCAAATTTGAATTTGAATTATATTCAAAATTTGAATTCAAATATTTTCTATATATAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTATAAAT[C/T]
CAAAGTTTATAAGTCAAAAAATTACATGCCCAATTCAAATTTAAATTTGAATTCAAATTTTTTTTATATAGTATTTCTATACATAAATTTTTCTAACTTT
AAAGTTAGAAAAATTTATGTATAGAAATACTATATAAAAAAAATTTGAATTCAAATTTAAATTTGAATTGGGCATGTAATTTTTTGACTTATAAACTTTG[G/A]
ATTTATAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTATATATAGAAAATATTTGAATTCAAATTTTGAATATAATTCAAATTCAAATTTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 35.60% | 9.08% | 13.82% | NA |
| All Indica | 2759 | 61.10% | 4.10% | 12.61% | 22.22% | NA |
| All Japonica | 1512 | 0.60% | 93.30% | 4.63% | 1.46% | NA |
| Aus | 269 | 88.50% | 8.90% | 0.00% | 2.60% | NA |
| Indica I | 595 | 60.80% | 2.00% | 12.77% | 24.37% | NA |
| Indica II | 465 | 27.50% | 4.50% | 23.23% | 44.73% | NA |
| Indica III | 913 | 75.60% | 1.80% | 9.75% | 12.92% | NA |
| Indica Intermediate | 786 | 64.20% | 8.10% | 9.54% | 18.07% | NA |
| Temperate Japonica | 767 | 0.70% | 88.70% | 7.82% | 2.87% | NA |
| Tropical Japonica | 504 | 0.40% | 98.00% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 98.30% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 25.60% | 50.00% | 12.22% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715840651 | C -> DEL | N | N | silent_mutation | Average:21.462; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0715840651 | C -> T | LOC_Os07g27250.1 | downstream_gene_variant ; 653.0bp to feature; MODIFIER | silent_mutation | Average:21.462; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0715840651 | C -> T | LOC_Os07g27240-LOC_Os07g27250 | intergenic_region ; MODIFIER | silent_mutation | Average:21.462; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715840651 | NA | 3.50E-17 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 2.61E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 3.11E-09 | mr1578 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 5.52E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 1.08E-08 | mr1637 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 8.31E-13 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 4.61E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 1.19E-10 | mr1945 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 1.30E-32 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715840651 | NA | 4.80E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |