\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715840651:

Variant ID: vg0715840651 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15840651
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, T: 0.24, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TCAAATTTGAATTTGAATTATATTCAAAATTTGAATTCAAATATTTTCTATATATAGTATTTCTATACATCTAAAGTTTATACACCTAAAGTTTATAAAT[C/T]
CAAAGTTTATAAGTCAAAAAATTACATGCCCAATTCAAATTTAAATTTGAATTCAAATTTTTTTTATATAGTATTTCTATACATAAATTTTTCTAACTTT

Reverse complement sequence

AAAGTTAGAAAAATTTATGTATAGAAATACTATATAAAAAAAATTTGAATTCAAATTTAAATTTGAATTGGGCATGTAATTTTTTGACTTATAAACTTTG[G/A]
ATTTATAAACTTTAGGTGTATAAACTTTAGATGTATAGAAATACTATATATAGAAAATATTTGAATTCAAATTTTGAATATAATTCAAATTCAAATTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 35.60% 9.08% 13.82% NA
All Indica  2759 61.10% 4.10% 12.61% 22.22% NA
All Japonica  1512 0.60% 93.30% 4.63% 1.46% NA
Aus  269 88.50% 8.90% 0.00% 2.60% NA
Indica I  595 60.80% 2.00% 12.77% 24.37% NA
Indica II  465 27.50% 4.50% 23.23% 44.73% NA
Indica III  913 75.60% 1.80% 9.75% 12.92% NA
Indica Intermediate  786 64.20% 8.10% 9.54% 18.07% NA
Temperate Japonica  767 0.70% 88.70% 7.82% 2.87% NA
Tropical Japonica  504 0.40% 98.00% 1.59% 0.00% NA
Japonica Intermediate  241 0.80% 98.30% 0.83% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 25.60% 50.00% 12.22% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715840651 C -> DEL N N silent_mutation Average:21.462; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0715840651 C -> T LOC_Os07g27250.1 downstream_gene_variant ; 653.0bp to feature; MODIFIER silent_mutation Average:21.462; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N
vg0715840651 C -> T LOC_Os07g27240-LOC_Os07g27250 intergenic_region ; MODIFIER silent_mutation Average:21.462; most accessible tissue: Zhenshan97 panicle, score: 36.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715840651 NA 3.50E-17 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 2.61E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 3.11E-09 mr1578 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 5.52E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 1.08E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 8.31E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 4.61E-08 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 1.19E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 1.30E-32 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715840651 NA 4.80E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251