\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715824291:

Variant ID: vg0715824291 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15824291
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, C: 0.32, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTTGATCGCTATTAGATCAGACAATTTCATCTCATGAATCCCACTGTAGAAATAGCTATGAAATTGCTTCTCTAAATCGGCCCAACTATTAATTGAT[C/A]
CATATGGTAAAGAGGAAAACCAAGTAAAGGCCGATCCAGACAAGGATAATTGGAACAACCTAACCCTTAAGGCGTCCACAGCCGATGCTTCACCGCACTT

Reverse complement sequence

AAGTGCGGTGAAGCATCGGCTGTGGACGCCTTAAGGGTTAGGTTGTTCCAATTATCCTTGTCTGGATCGGCCTTTACTTGGTTTTCCTCTTTACCATATG[G/T]
ATCAATTAATAGTTGGGCCGATTTAGAGAAGCAATTTCATAGCTATTTCTACAGTGGGATTCATGAGATGAAATTGTCTGATCTAATAGCGATCAAGCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 34.90% 0.28% 0.32% NA
All Indica  2759 96.20% 3.30% 0.22% 0.29% NA
All Japonica  1512 6.70% 93.10% 0.00% 0.20% NA
Aus  269 88.50% 8.90% 2.60% 0.00% NA
Indica I  595 98.70% 1.00% 0.00% 0.34% NA
Indica II  465 95.70% 3.90% 0.22% 0.22% NA
Indica III  913 98.80% 0.90% 0.00% 0.33% NA
Indica Intermediate  786 91.70% 7.40% 0.64% 0.25% NA
Temperate Japonica  767 11.50% 88.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 0.00% 1.24% NA
VI/Aromatic  96 8.30% 90.60% 0.00% 1.04% NA
Intermediate  90 50.00% 46.70% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715824291 C -> DEL LOC_Os07g27230.1 N frameshift_variant Average:54.932; most accessible tissue: Zhenshan97 young leaf, score: 76.44 N N N N
vg0715824291 C -> A LOC_Os07g27230.1 missense_variant ; p.Gly328Val; MODERATE nonsynonymous_codon ; G328V Average:54.932; most accessible tissue: Zhenshan97 young leaf, score: 76.44 probably damaging 2.077 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715824291 NA 2.25E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 1.40E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 5.56E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 3.81E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 8.72E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 8.07E-66 mr1538 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 6.51E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 4.02E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 2.72E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 1.19E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 1.96E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 5.91E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 3.16E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 6.16E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 2.19E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 2.58E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 5.64E-06 mr1133_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 1.72E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 8.15E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 4.45E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 6.27E-25 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 1.94E-22 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 3.62E-36 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 1.72E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715824291 NA 7.61E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251