\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715817404:

Variant ID: vg0715817404 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 15817404
Reference Allele: GTAlternative Allele: G,AT
Primary Allele: GTSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAGTCAGAGTCAGACTAGGTTAAGTGATACGGCCGATTACGACAATATGACTCATTTATGACGCCGGGTCTGAGTTGATGTGCTTGAAGATGATTGTC[GT/G,AT]
ACATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTCATGTAAATTCCTTAGAGATAAATGTGGGCAAAAGTCTGCCGCAAAGACT

Reverse complement sequence

AGTCTTTGCGGCAGACTTTTGCCCACATTTATCTCTAAGGAATTTACATGAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGT[AC/C,AT]
GACAATCATCTTCAAGCACATCAACTCAGACCCGGCGTCATAAATGAGTCATATTGTCGTAATCGGCCGTATCACTTAACCTAGTCTGACTCTGACTTAG

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.00% 2.40% 23.78% 35.55% AT: 1.29%
All Indica  2759 7.00% 0.90% 38.31% 51.76% AT: 2.03%
All Japonica  1512 91.60% 5.60% 0.46% 2.18% AT: 0.13%
Aus  269 11.50% 1.10% 14.50% 72.12% AT: 0.74%
Indica I  595 4.50% 0.00% 44.20% 49.24% AT: 2.02%
Indica II  465 10.10% 0.00% 29.03% 60.22% AT: 0.65%
Indica III  913 2.50% 0.10% 39.32% 54.65% AT: 3.40%
Indica Intermediate  786 12.20% 3.10% 38.17% 45.29% AT: 1.27%
Temperate Japonica  767 85.30% 9.90% 0.78% 4.04% NA
Tropical Japonica  504 98.00% 1.60% 0.20% 0.00% AT: 0.20%
Japonica Intermediate  241 98.30% 0.40% 0.00% 0.83% AT: 0.41%
VI/Aromatic  96 91.70% 0.00% 3.12% 5.21% NA
Intermediate  90 56.70% 0.00% 20.00% 22.22% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715817404 GT -> DEL N N silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N
vg0715817404 GT -> G LOC_Os07g27210.1 upstream_gene_variant ; 1018.0bp to feature; MODIFIER silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N
vg0715817404 GT -> G LOC_Os07g27230.1 downstream_gene_variant ; 2346.0bp to feature; MODIFIER silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N
vg0715817404 GT -> G LOC_Os07g27220.1 intron_variant ; MODIFIER silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N
vg0715817404 GT -> AT LOC_Os07g27210.1 upstream_gene_variant ; 1017.0bp to feature; MODIFIER silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N
vg0715817404 GT -> AT LOC_Os07g27230.1 downstream_gene_variant ; 2347.0bp to feature; MODIFIER silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N
vg0715817404 GT -> AT LOC_Os07g27220.1 intron_variant ; MODIFIER silent_mutation Average:11.005; most accessible tissue: Callus, score: 24.056 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715817404 3.76E-06 NA mr1054 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 1.38E-06 1.38E-06 mr1054 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 4.47E-06 mr1187 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 8.08E-06 NA mr1286 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 5.00E-06 4.00E-06 mr1286 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 4.69E-06 NA mr1287 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 3.05E-06 3.05E-06 mr1287 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 8.90E-06 NA mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 8.95E-06 3.67E-06 mr1372 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 7.31E-07 7.31E-07 mr1474 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 7.31E-07 7.31E-07 mr1475 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 8.96E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 7.01E-06 mr1509 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 1.84E-06 NA mr1512 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 6.82E-06 6.82E-06 mr1512 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 5.17E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 1.12E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 3.78E-06 3.78E-06 mr1643 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 8.16E-06 8.16E-06 mr1661 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 4.90E-11 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 1.71E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404 NA 6.93E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251