Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715817404:

Variant ID: vg0715817404 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 15817404
Reference Allele: GT	Alternative Allele: G,AT
Primary Allele: GT	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTAAGTCAGAGTCAGACTAGGTTAAGTGATACGGCCGATTACGACAATATGACTCATTTATGACGCCGGGTCTGAGTTGATGTGCTTGAAGATGATTGTC[GT/G,AT]
ACATGGATAGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTCATGTAAATTCCTTAGAGATAAATGTGGGCAAAAGTCTGCCGCAAAGACT

Reverse complement sequence

AGTCTTTGCGGCAGACTTTTGCCCACATTTATCTCTAAGGAATTTACATGAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCTATCCATGT[AC/C,AT]
GACAATCATCTTCAAGCACATCAACTCAGACCCGGCGTCATAAATGAGTCATATTGTCGTAATCGGCCGTATCACTTAACCTAGTCTGACTCTGACTTAG

Allele Frequencies:

Populations	Population Size	Frequency of GT(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.00%	2.40%	23.78%	35.55%	AT: 1.29%
All Indica	2759	7.00%	0.90%	38.31%	51.76%	AT: 2.03%
All Japonica	1512	91.60%	5.60%	0.46%	2.18%	AT: 0.13%
Aus	269	11.50%	1.10%	14.50%	72.12%	AT: 0.74%
Indica I	595	4.50%	0.00%	44.20%	49.24%	AT: 2.02%
Indica II	465	10.10%	0.00%	29.03%	60.22%	AT: 0.65%
Indica III	913	2.50%	0.10%	39.32%	54.65%	AT: 3.40%
Indica Intermediate	786	12.20%	3.10%	38.17%	45.29%	AT: 1.27%
Temperate Japonica	767	85.30%	9.90%	0.78%	4.04%	NA
Tropical Japonica	504	98.00%	1.60%	0.20%	0.00%	AT: 0.20%
Japonica Intermediate	241	98.30%	0.40%	0.00%	0.83%	AT: 0.41%
VI/Aromatic	96	91.70%	0.00%	3.12%	5.21%	NA
Intermediate	90	56.70%	0.00%	20.00%	22.22%	AT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715817404	GT -> DEL	N	N	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N
vg0715817404	GT -> G	LOC_Os07g27210.1	upstream_gene_variant ; 1018.0bp to feature; MODIFIER	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N
vg0715817404	GT -> G	LOC_Os07g27230.1	downstream_gene_variant ; 2346.0bp to feature; MODIFIER	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N
vg0715817404	GT -> G	LOC_Os07g27220.1	intron_variant ; MODIFIER	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N
vg0715817404	GT -> AT	LOC_Os07g27210.1	upstream_gene_variant ; 1017.0bp to feature; MODIFIER	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N
vg0715817404	GT -> AT	LOC_Os07g27230.1	downstream_gene_variant ; 2347.0bp to feature; MODIFIER	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N
vg0715817404	GT -> AT	LOC_Os07g27220.1	intron_variant ; MODIFIER	silent_mutation	Average:11.005; most accessible tissue: Callus, score: 24.056	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715817404	3.76E-06	NA	mr1054	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	1.38E-06	1.38E-06	mr1054	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	4.47E-06	mr1187	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	8.08E-06	NA	mr1286	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	5.00E-06	4.00E-06	mr1286	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	4.69E-06	NA	mr1287	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	3.05E-06	3.05E-06	mr1287	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	8.90E-06	NA	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	8.95E-06	3.67E-06	mr1372	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	7.31E-07	7.31E-07	mr1474	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	7.31E-07	7.31E-07	mr1475	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	8.96E-16	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	7.01E-06	mr1509	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	1.84E-06	NA	mr1512	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	6.82E-06	6.82E-06	mr1512	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	5.17E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	1.12E-08	mr1637	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	3.78E-06	3.78E-06	mr1643	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	8.16E-06	8.16E-06	mr1661	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	4.90E-11	mr1663	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	1.71E-22	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715817404	NA	6.93E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251