\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715801545:

Variant ID: vg0715801545 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15801545
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATTTAACCTAATCGGCTGCCTTCTACTAACAGATGTTAGCCGATTATAGGTTAGATGACGATATTATCAAAGATTATATAAGATATATGATGACTCGA[C/T]
AAATTACATAGACAATATTAGAGTATCATAAAGATGGAAGCACTAATCTCGAGAACGCAAGCCGCCATAACAAGTTTTACCTCTTGTTGAAGATCGAAAC

Reverse complement sequence

GTTTCGATCTTCAACAAGAGGTAAAACTTGTTATGGCGGCTTGCGTTCTCGAGATTAGTGCTTCCATCTTTATGATACTCTAATATTGTCTATGTAATTT[G/A]
TCGAGTCATCATATATCTTATATAATCTTTGATAATATCGTCATCTAACCTATAATCGGCTAACATCTGTTAGTAGAAGGCAGCCGATTAGGTTAAATAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 34.90% 0.78% 0.83% NA
All Indica  2759 94.60% 3.20% 1.16% 1.12% NA
All Japonica  1512 6.70% 93.20% 0.00% 0.07% NA
Aus  269 88.10% 8.90% 0.37% 2.60% NA
Indica I  595 99.20% 0.70% 0.17% 0.00% NA
Indica II  465 95.10% 3.90% 0.65% 0.43% NA
Indica III  913 95.30% 0.70% 1.97% 2.08% NA
Indica Intermediate  786 89.90% 7.50% 1.27% 1.27% NA
Temperate Japonica  767 11.50% 88.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 98.00% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 51.10% 44.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715801545 C -> DEL N N silent_mutation Average:31.183; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0715801545 C -> T LOC_Os07g27200.1 upstream_gene_variant ; 883.0bp to feature; MODIFIER silent_mutation Average:31.183; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N
vg0715801545 C -> T LOC_Os07g27190-LOC_Os07g27200 intergenic_region ; MODIFIER silent_mutation Average:31.183; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715801545 NA 2.31E-21 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 3.77E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 7.15E-06 mr1171 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 1.29E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 5.46E-06 4.13E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 3.27E-13 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 1.44E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 5.36E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 2.76E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 4.69E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 1.28E-06 1.08E-60 mr1594 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 2.04E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 6.48E-06 NA mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 3.59E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 5.21E-40 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 9.04E-41 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 4.68E-07 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 1.84E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 1.50E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 1.56E-31 mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715801545 NA 4.50E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251