\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715763923:

Variant ID: vg0715763923 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15763923
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.36, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGTGAGCTTCGGCTTTTTGGTCATTTGGAAACTAGATGACTCATCCTTTGCAACTTTATGATCTTCGGCCTTCGCATTTTTGATCCTATTCTTGGGC[C/T]
GAGGATCCCCAATAATAACACTTTTCCCTTTCTTTTTGTCAACATCAATAGGACTAATAGGGAGAGGATTACTAAAAATTTCGGTCTATGGCATAGATGT

Reverse complement sequence

ACATCTATGCCATAGACCGAAATTTTTAGTAATCCTCTCCCTATTAGTCCTATTGATGTTGACAAAAAGAAAGGGAAAAGTGTTATTATTGGGGATCCTC[G/A]
GCCCAAGAATAGGATCAAAAATGCGAAGGCCGAAGATCATAAAGTTGCAAAGGATGAGTCATCTAGTTTCCAAATGACCAAAAAGCCGAAGCTCACTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.50% 34.90% 0.42% 0.21% NA
All Indica  2759 96.20% 3.20% 0.29% 0.33% NA
All Japonica  1512 6.70% 93.10% 0.07% 0.07% NA
Aus  269 88.50% 8.90% 2.60% 0.00% NA
Indica I  595 99.00% 0.70% 0.00% 0.34% NA
Indica II  465 95.10% 4.10% 0.22% 0.65% NA
Indica III  913 99.00% 0.70% 0.22% 0.11% NA
Indica Intermediate  786 91.30% 7.60% 0.64% 0.38% NA
Temperate Japonica  767 11.50% 88.50% 0.00% 0.00% NA
Tropical Japonica  504 2.00% 97.80% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.00% 0.41% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 50.00% 45.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715763923 C -> DEL LOC_Os07g27170.1 N frameshift_variant Average:29.962; most accessible tissue: Minghui63 flag leaf, score: 39.69 N N N N
vg0715763923 C -> T LOC_Os07g27170.1 missense_variant ; p.Arg560Gln; MODERATE nonsynonymous_codon ; R560Q Average:29.962; most accessible tissue: Minghui63 flag leaf, score: 39.69 possibly damaging 1.699 DELETERIOUS 0.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715763923 NA 1.88E-27 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 5.07E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.42E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 2.04E-18 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 4.99E-21 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 2.27E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.99E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.30E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.30E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 4.04E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 8.34E-39 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.64E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 7.04E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.70E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 9.27E-30 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 4.53E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.23E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.23E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 2.70E-24 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 1.04E-06 2.89E-37 mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 4.98E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 1.05E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715763923 NA 3.23E-20 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251