Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715756182:

Variant ID: vg0715756182 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15756182
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCACTGTCTTCCTCTAATATTGGGTATAGAGGTTTAGGCCCCTTTGATTCAAAGAAAATTCATAAGAATTTTAGAGGATTTCATTCCTATAGGATTTTTT[C/T]
CTATATAGTCCTTTGAATCAAAGGAATAGATCTTATAGAATCCTATAAAATTCCTATGGATTGGCTAATGCCATGCATGTTTTGGAGGAATTCTAACATG

Reverse complement sequence

CATGTTAGAATTCCTCCAAAACATGCATGGCATTAGCCAATCCATAGGAATTTTATAGGATTCTATAAGATCTATTCCTTTGATTCAAAGGACTATATAG[G/A]
AAAAAATCCTATAGGAATGAAATCCTCTAAAATTCTTATGAATTTTCTTTGAATCAAAGGGGCCTAAACCTCTATACCCAATATTAGAGGAAGACAGTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.50%	18.50%	30.30%	13.80%	NA
All Indica	2759	31.10%	2.40%	45.70%	20.77%	NA
All Japonica	1512	53.00%	45.90%	0.93%	0.20%	NA
Aus	269	27.10%	0.00%	47.96%	24.91%	NA
Indica I	595	24.00%	0.70%	60.00%	15.29%	NA
Indica II	465	23.00%	1.50%	44.30%	31.18%	NA
Indica III	913	39.00%	1.40%	39.43%	20.15%	NA
Indica Intermediate	786	32.20%	5.30%	43.00%	19.47%	NA
Temperate Japonica	767	83.30%	14.90%	1.56%	0.26%	NA
Tropical Japonica	504	20.60%	79.20%	0.20%	0.00%	NA
Japonica Intermediate	241	24.10%	75.10%	0.41%	0.41%	NA
VI/Aromatic	96	8.30%	88.50%	3.12%	0.00%	NA
Intermediate	90	32.20%	30.00%	27.78%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715756182	C -> DEL	N	N	silent_mutation	Average:50.484; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0715756182	C -> T	LOC_Os07g27150.1	downstream_gene_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:50.484; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0715756182	C -> T	LOC_Os07g27170.1	downstream_gene_variant ; 3379.0bp to feature; MODIFIER	silent_mutation	Average:50.484; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0715756182	C -> T	LOC_Os07g27150.2	downstream_gene_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:50.484; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0715756182	C -> T	LOC_Os07g27150.3	downstream_gene_variant ; 210.0bp to feature; MODIFIER	silent_mutation	Average:50.484; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N
vg0715756182	C -> T	LOC_Os07g27150-LOC_Os07g27170	intergenic_region ; MODIFIER	silent_mutation	Average:50.484; most accessible tissue: Zhenshan97 panicle, score: 63.607	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715756182	NA	3.96E-06	mr1398	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	NA	6.19E-07	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	2.89E-06	NA	mr1891	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	NA	1.87E-07	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	NA	7.12E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	NA	4.81E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	NA	2.69E-10	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715756182	NA	2.97E-08	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251