\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715724667:

Variant ID: vg0715724667 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15724667
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCCCTTTGAATCGTAGGAATGAAAAAACAGAGGAATAGGAAAAACACAGGATTCTGACAGGAATACAATTGTAAAACAGAGGATTGCAAAACACAGGAAA[A/G]
ACACAGGAATGGCTGTTTGATTGGACCACAGGAAAAACGCAGGAATCAGATGAGAGAGATAGACTCAGAGGAAATGTTCCAAGAGGTTAGACCTCTTGCT

Reverse complement sequence

AGCAAGAGGTCTAACCTCTTGGAACATTTCCTCTGAGTCTATCTCTCTCATCTGATTCCTGCGTTTTTCCTGTGGTCCAATCAAACAGCCATTCCTGTGT[T/C]
TTTCCTGTGTTTTGCAATCCTCTGTTTTACAATTGTATTCCTGTCAGAATCCTGTGTTTTTCCTATTCCTCTGTTTTTTCATTCCTACGATTCAAAGGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 37.70% 0.25% 1.18% NA
All Indica  2759 93.20% 4.70% 0.33% 1.70% NA
All Japonica  1512 1.00% 99.00% 0.00% 0.00% NA
Aus  269 87.40% 10.00% 0.00% 2.60% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 92.00% 3.90% 0.86% 3.23% NA
Indica III  913 99.00% 0.80% 0.11% 0.11% NA
Indica Intermediate  786 83.00% 12.80% 0.25% 3.94% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 0.60% 99.40% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 1.04% 0.00% NA
Intermediate  90 52.20% 43.30% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715724667 A -> DEL N N silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27120.1 upstream_gene_variant ; 1620.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27120.2 upstream_gene_variant ; 1620.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27120.3 upstream_gene_variant ; 1669.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27120.4 upstream_gene_variant ; 1669.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27120.5 upstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27120.6 upstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27110.1 downstream_gene_variant ; 1549.0bp to feature; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0715724667 A -> G LOC_Os07g27110-LOC_Os07g27120 intergenic_region ; MODIFIER silent_mutation Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715724667 4.64E-06 NA mr1243 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667 NA 9.16E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667 NA 9.14E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667 NA 7.61E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667 NA 1.48E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251