Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715724667:

Variant ID: vg0715724667 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15724667
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CCCCTTTGAATCGTAGGAATGAAAAAACAGAGGAATAGGAAAAACACAGGATTCTGACAGGAATACAATTGTAAAACAGAGGATTGCAAAACACAGGAAA[A/G]
ACACAGGAATGGCTGTTTGATTGGACCACAGGAAAAACGCAGGAATCAGATGAGAGAGATAGACTCAGAGGAAATGTTCCAAGAGGTTAGACCTCTTGCT

Reverse complement sequence

AGCAAGAGGTCTAACCTCTTGGAACATTTCCTCTGAGTCTATCTCTCTCATCTGATTCCTGCGTTTTTCCTGTGGTCCAATCAAACAGCCATTCCTGTGT[T/C]
TTTCCTGTGTTTTGCAATCCTCTGTTTTACAATTGTATTCCTGTCAGAATCCTGTGTTTTTCCTATTCCTCTGTTTTTTCATTCCTACGATTCAAAGGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	37.70%	0.25%	1.18%	NA
All Indica	2759	93.20%	4.70%	0.33%	1.70%	NA
All Japonica	1512	1.00%	99.00%	0.00%	0.00%	NA
Aus	269	87.40%	10.00%	0.00%	2.60%	NA
Indica I	595	98.80%	0.80%	0.34%	0.00%	NA
Indica II	465	92.00%	3.90%	0.86%	3.23%	NA
Indica III	913	99.00%	0.80%	0.11%	0.11%	NA
Indica Intermediate	786	83.00%	12.80%	0.25%	3.94%	NA
Temperate Japonica	767	1.00%	99.00%	0.00%	0.00%	NA
Tropical Japonica	504	0.60%	99.40%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	91.70%	1.04%	0.00%	NA
Intermediate	90	52.20%	43.30%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715724667	A -> DEL	N	N	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27120.1	upstream_gene_variant ; 1620.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27120.2	upstream_gene_variant ; 1620.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27120.3	upstream_gene_variant ; 1669.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27120.4	upstream_gene_variant ; 1669.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27120.5	upstream_gene_variant ; 1674.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27120.6	upstream_gene_variant ; 1674.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27110.1	downstream_gene_variant ; 1549.0bp to feature; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N
vg0715724667	A -> G	LOC_Os07g27110-LOC_Os07g27120	intergenic_region ; MODIFIER	silent_mutation	Average:35.79; most accessible tissue: Zhenshan97 flag leaf, score: 68.25	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715724667	4.64E-06	NA	mr1243	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667	NA	9.16E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667	NA	9.14E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667	NA	7.61E-09	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715724667	NA	1.48E-07	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251