Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715703952:

Variant ID: vg0715703952 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15703952
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTCGGAATATGGTTTCTTTGTTTGTTTCATGTGTAGGTGACTCGATGCCTCGGGAGAGTATTTGCGGTGATGGACCGGGAGTCGGCTTGGTGGTAAGA[T/C]
GATGTCTGTGGTGGTCAGATATCATGCGGGATACTTAGGCTAGAGTTGATGCACGTGGTTGGTGAAGATTCCATATGGCGTACGATGGAGGTATTGTGTG

Reverse complement sequence

CACACAATACCTCCATCGTACGCCATATGGAATCTTCACCAACCACGTGCATCAACTCTAGCCTAAGTATCCCGCATGATATCTGACCACCACAGACATC[A/G]
TCTTACCACCAAGCCGACTCCCGGTCCATCACCGCAAATACTCTCCCGAGGCATCGAGTCACCTACACATGAAACAAACAAAGAAACCATATTCCGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.00%	46.20%	1.27%	0.51%	NA
All Indica	2759	78.90%	18.50%	1.78%	0.87%	NA
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	85.10%	11.90%	2.97%	0.00%	NA
Indica I	595	94.80%	3.90%	1.18%	0.17%	NA
Indica II	465	90.80%	6.70%	1.94%	0.65%	NA
Indica III	913	67.90%	28.30%	1.97%	1.86%	NA
Indica Intermediate	786	72.50%	25.20%	1.91%	0.38%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	92.70%	0.00%	0.00%	NA
Intermediate	90	37.80%	58.90%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715703952	T -> DEL	N	N	silent_mutation	Average:34.355; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0715703952	T -> C	LOC_Os07g27090.1	upstream_gene_variant ; 810.0bp to feature; MODIFIER	silent_mutation	Average:34.355; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0715703952	T -> C	LOC_Os07g27080.1	downstream_gene_variant ; 3912.0bp to feature; MODIFIER	silent_mutation	Average:34.355; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0715703952	T -> C	LOC_Os07g27080-LOC_Os07g27090	intergenic_region ; MODIFIER	silent_mutation	Average:34.355; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715703952	NA	3.05E-07	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	3.96E-06	8.92E-08	mr1043	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.18E-42	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.25E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	3.65E-32	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.38E-18	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	2.72E-25	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.46E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	2.75E-06	mr1181	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.94E-31	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	2.06E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	3.33E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	4.62E-06	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	3.36E-32	mr1448	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	4.06E-06	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.37E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	9.02E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	6.36E-18	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	6.47E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	3.41E-11	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	5.34E-28	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	4.38E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	9.04E-54	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	6.43E-25	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.45E-08	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	7.97E-06	mr1975	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	1.07E-57	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	3.34E-36	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	2.08E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	7.17E-33	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703952	NA	3.29E-06	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251