\
| Variant ID: vg0715703024 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15703024 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATCATTGGTATCGGGTACCATGCAGCTGATACCACAAGAGGTATCAGGTATCAAGTACAATCTCATATCAAACGGGATACCGTTGTTTAGGCTTTCTGTA[C/T]
ATAAATCTGCCCTTTTTTTTCTGCGAACTTCACATTAAGGTTCCAAAATAAACAAATAAATCTGAATTGCAGCAGCCATGTTGAATTGGTCATCTGAATT
AATTCAGATGACCAATTCAACATGGCTGCTGCAATTCAGATTTATTTGTTTATTTTGGAACCTTAATGTGAAGTTCGCAGAAAAAAAAGGGCAGATTTAT[G/A]
TACAGAAAGCCTAAACAACGGTATCCCGTTTGATATGAGATTGTACTTGATACCTGATACCTCTTGTGGTATCAGCTGCATGGTACCCGATACCAATGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.10% | 0.68% | 0.06% | NA |
| All Indica | 2759 | 82.20% | 16.90% | 0.76% | 0.11% | NA |
| All Japonica | 1512 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.00% | 10.40% | 2.60% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.20% | 1.01% | 0.34% | NA |
| Indica II | 465 | 94.20% | 4.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 72.10% | 27.60% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 75.30% | 23.50% | 1.02% | 0.13% | NA |
| Temperate Japonica | 767 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 53.30% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715703024 | C -> DEL | N | N | silent_mutation | Average:49.131; most accessible tissue: Callus, score: 64.097 | N | N | N | N |
| vg0715703024 | C -> T | LOC_Os07g27090.1 | upstream_gene_variant ; 1738.0bp to feature; MODIFIER | silent_mutation | Average:49.131; most accessible tissue: Callus, score: 64.097 | N | N | N | N |
| vg0715703024 | C -> T | LOC_Os07g27080.1 | downstream_gene_variant ; 2984.0bp to feature; MODIFIER | silent_mutation | Average:49.131; most accessible tissue: Callus, score: 64.097 | N | N | N | N |
| vg0715703024 | C -> T | LOC_Os07g27080-LOC_Os07g27090 | intergenic_region ; MODIFIER | silent_mutation | Average:49.131; most accessible tissue: Callus, score: 64.097 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715703024 | NA | 1.94E-28 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 3.18E-32 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.13E-18 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 3.07E-24 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 8.54E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 3.27E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 6.24E-06 | mr1181 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.52E-31 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 7.40E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.53E-06 | mr1457 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.10E-08 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 6.01E-12 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 4.17E-52 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.87E-54 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 4.25E-25 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.34E-09 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.01E-57 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.89E-06 | mr1144_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.20E-36 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 9.33E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.22E-08 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 2.07E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 6.19E-07 | mr1548_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 4.68E-08 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 1.06E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 2.32E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 2.70E-34 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 2.25E-07 | mr1908_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | NA | 2.24E-06 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715703024 | 1.97E-06 | 6.71E-10 | mr1996_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |