\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715703024:

Variant ID: vg0715703024 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15703024
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCATTGGTATCGGGTACCATGCAGCTGATACCACAAGAGGTATCAGGTATCAAGTACAATCTCATATCAAACGGGATACCGTTGTTTAGGCTTTCTGTA[C/T]
ATAAATCTGCCCTTTTTTTTCTGCGAACTTCACATTAAGGTTCCAAAATAAACAAATAAATCTGAATTGCAGCAGCCATGTTGAATTGGTCATCTGAATT

Reverse complement sequence

AATTCAGATGACCAATTCAACATGGCTGCTGCAATTCAGATTTATTTGTTTATTTTGGAACCTTAATGTGAAGTTCGCAGAAAAAAAAGGGCAGATTTAT[G/A]
TACAGAAAGCCTAAACAACGGTATCCCGTTTGATATGAGATTGTACTTGATACCTGATACCTCTTGTGGTATCAGCTGCATGGTACCCGATACCAATGAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.10% 0.68% 0.06% NA
All Indica  2759 82.20% 16.90% 0.76% 0.11% NA
All Japonica  1512 0.90% 99.10% 0.00% 0.00% NA
Aus  269 87.00% 10.40% 2.60% 0.00% NA
Indica I  595 97.50% 1.20% 1.01% 0.34% NA
Indica II  465 94.20% 4.90% 0.86% 0.00% NA
Indica III  913 72.10% 27.60% 0.33% 0.00% NA
Indica Intermediate  786 75.30% 23.50% 1.02% 0.13% NA
Temperate Japonica  767 1.00% 99.00% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 42.20% 53.30% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715703024 C -> DEL N N silent_mutation Average:49.131; most accessible tissue: Callus, score: 64.097 N N N N
vg0715703024 C -> T LOC_Os07g27090.1 upstream_gene_variant ; 1738.0bp to feature; MODIFIER silent_mutation Average:49.131; most accessible tissue: Callus, score: 64.097 N N N N
vg0715703024 C -> T LOC_Os07g27080.1 downstream_gene_variant ; 2984.0bp to feature; MODIFIER silent_mutation Average:49.131; most accessible tissue: Callus, score: 64.097 N N N N
vg0715703024 C -> T LOC_Os07g27080-LOC_Os07g27090 intergenic_region ; MODIFIER silent_mutation Average:49.131; most accessible tissue: Callus, score: 64.097 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715703024 NA 1.94E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 3.18E-32 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.13E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 3.07E-24 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 8.54E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 3.27E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 6.24E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.52E-31 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 7.40E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.53E-06 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.10E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 6.01E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 4.17E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.87E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 4.25E-25 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.34E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.01E-57 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.89E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.20E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 9.33E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.22E-08 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 2.07E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 6.19E-07 mr1548_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 4.68E-08 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 1.06E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 2.32E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 2.70E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 2.25E-07 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 NA 2.24E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715703024 1.97E-06 6.71E-10 mr1996_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251