\
| Variant ID: vg0715689711 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15689711 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCTCGTAGTAAAGGTAGGCAAGAGGTTAAGCTTGAACCGGGTGATTTAGTTTGGTTGCACTTGCAAAAGGATAGATTTCCGGAATTGAGAAAGTCTAAG[T/C]
TGATGCCTCGTGCTGATGGTCCTTTTAAAATTATTGAGAAGATTAATGATAATGTATATAAACTTGAGTTGCCTCCCGAGTTTGGGGTTAGTACCACATT
AATGTGGTACTAACCCCAAACTCGGGAGGCAACTCAAGTTTATATACATTATCATTAATCTTCTCAATAATTTTAAAAGGACCATCAGCACGAGGCATCA[A/G]
CTTAGACTTTCTCAATTCCGGAAATCTATCCTTTTGCAAGTGCAACCAAACTAAATCACCCGGTTCAAGCTTAACCTCTTGCCTACCTTTACTACGAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.80% | 45.40% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 81.70% | 17.30% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.00% | 10.40% | 2.60% | 0.00% | NA |
| Indica I | 595 | 96.80% | 1.70% | 1.51% | 0.00% | NA |
| Indica II | 465 | 93.10% | 5.60% | 1.29% | 0.00% | NA |
| Indica III | 913 | 72.00% | 27.90% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 74.90% | 23.70% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 0.90% | 99.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 40.00% | 58.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715689711 | T -> C | LOC_Os07g27070.1 | synonymous_variant ; p.Leu969Leu; LOW | synonymous_codon | Average:19.491; most accessible tissue: Callus, score: 37.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715689711 | NA | 1.45E-29 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 3.92E-33 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 3.26E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 2.93E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 2.21E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 7.04E-24 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 8.16E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 7.18E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 1.09E-32 | mr1202 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 3.86E-06 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 2.80E-07 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 6.39E-09 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 2.12E-12 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 1.18E-09 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 8.78E-07 | mr1212_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 6.44E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 1.06E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 2.35E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715689711 | NA | 1.14E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |