Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715684046:

Variant ID: vg0715684046 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 15684046
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:

AAGCCAAAAAAAAATTTAGTCGTTAGTTACCTTAACCTATACCGTTTTTAGCCTTTGCATGATTCTTTTTCAGAGTCCGTAGTGTTGAGTTTGAGTCCTA[A/G]
TTAAAGTTCCTGTTGCTGGTCTAGTGCGTGTTTTAGTCTAGTCATGTGTTTTTCCTTTGTAACCCTAGCCGCCACCTTTCACCGTGTGTTAGGGTTCATC

Reverse complement sequence

GATGAACCCTAACACACGGTGAAAGGTGGCGGCTAGGGTTACAAAGGAAAAACACATGACTAGACTAAAACACGCACTAGACCAGCAACAGGAACTTTAA[T/C]
TAGGACTCAAACTCAACACTACGGACTCTGAAAAAGAATCATGCAAAGGCTAAAAACGGTATAGGTTAAGGTAACTAACGACTAAATTTTTTTTTGGCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	45.30%	0.89%	0.36%	NA
All Indica	2759	80.90%	17.30%	1.23%	0.58%	NA
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	88.10%	10.40%	1.49%	0.00%	NA
Indica I	595	97.30%	1.50%	0.17%	1.01%	NA
Indica II	465	93.80%	5.40%	0.00%	0.86%	NA
Indica III	913	70.20%	27.70%	1.86%	0.22%	NA
Indica Intermediate	786	73.40%	24.00%	2.04%	0.51%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.20%	98.80%	0.00%	0.00%	NA
VI/Aromatic	96	7.30%	91.70%	1.04%	0.00%	NA
Intermediate	90	41.10%	54.40%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0715684046	A -> DEL	N	N	silent_mutation	Average:36.031; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg0715684046	A -> G	LOC_Os07g27070.1	intron_variant ; MODIFIER	silent_mutation	Average:36.031; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0715684046	NA	3.28E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.66E-31	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.48E-18	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.21E-06	mr1121	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.79E-25	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.62E-07	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	3.16E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.04E-26	mr1181	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	5.93E-06	3.64E-08	mr1181	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.19E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.42E-11	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	7.68E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	8.66E-08	mr1457	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.43E-25	mr1537	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.53E-17	mr1566	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	6.04E-09	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.41E-12	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.95E-08	mr1770	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.69E-52	mr1795	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.15E-53	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.59E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	5.58E-09	mr1915	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.41E-57	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.42E-06	mr1111_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	7.96E-07	mr1144_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	2.27E-37	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	9.27E-07	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	6.88E-07	mr1244_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046	NA	1.06E-07	mr1996_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251