\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715684046:

Variant ID: vg0715684046 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15684046
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 168. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCCAAAAAAAAATTTAGTCGTTAGTTACCTTAACCTATACCGTTTTTAGCCTTTGCATGATTCTTTTTCAGAGTCCGTAGTGTTGAGTTTGAGTCCTA[A/G]
TTAAAGTTCCTGTTGCTGGTCTAGTGCGTGTTTTAGTCTAGTCATGTGTTTTTCCTTTGTAACCCTAGCCGCCACCTTTCACCGTGTGTTAGGGTTCATC

Reverse complement sequence

GATGAACCCTAACACACGGTGAAAGGTGGCGGCTAGGGTTACAAAGGAAAAACACATGACTAGACTAAAACACGCACTAGACCAGCAACAGGAACTTTAA[T/C]
TAGGACTCAAACTCAACACTACGGACTCTGAAAAAGAATCATGCAAAGGCTAAAAACGGTATAGGTTAAGGTAACTAACGACTAAATTTTTTTTTGGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.40% 45.30% 0.89% 0.36% NA
All Indica  2759 80.90% 17.30% 1.23% 0.58% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 88.10% 10.40% 1.49% 0.00% NA
Indica I  595 97.30% 1.50% 0.17% 1.01% NA
Indica II  465 93.80% 5.40% 0.00% 0.86% NA
Indica III  913 70.20% 27.70% 1.86% 0.22% NA
Indica Intermediate  786 73.40% 24.00% 2.04% 0.51% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 91.70% 1.04% 0.00% NA
Intermediate  90 41.10% 54.40% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715684046 A -> DEL N N silent_mutation Average:36.031; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg0715684046 A -> G LOC_Os07g27070.1 intron_variant ; MODIFIER silent_mutation Average:36.031; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715684046 NA 3.28E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.66E-31 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.48E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.21E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.79E-25 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.62E-07 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 3.16E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.04E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 5.93E-06 3.64E-08 mr1181 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.19E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.42E-11 mr1233 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 7.68E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 8.66E-08 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.43E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.53E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 6.04E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.41E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.95E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.69E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.15E-53 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.59E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 5.58E-09 mr1915 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.41E-57 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.42E-06 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 7.96E-07 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 2.27E-37 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 9.27E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 6.88E-07 mr1244_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715684046 NA 1.06E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251