\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715682872:

Variant ID: vg0715682872 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15682872
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAACCCTCGACTGCGACACATGGGTAGAAGGACCATCCAATGTTGCACATCGCCCCAATCGCGGCCACAACCTCCCACCACATGCCACATCGACACACGC[C/T]
AAAACCCAGCAGCTTTCTTCCCCAACTGTCGCCCCACTGGTTCACATGGGCTTGATGCGGACATCACTACCTCGAATACACACAACAATCCTCTAACAGT

Reverse complement sequence

ACTGTTAGAGGATTGTTGTGTGTATTCGAGGTAGTGATGTCCGCATCAAGCCCATGTGAACCAGTGGGGCGACAGTTGGGGAAGAAAGCTGCTGGGTTTT[G/A]
GCGTGTGTCGATGTGGCATGTGGTGGGAGGTTGTGGCCGCGATTGGGGCGATGTGCAACATTGGATGGTCCTTCTACCCATGTGTCGCAGTCGAGGGTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.20% 0.06% 0.55% NA
All Indica  2759 82.30% 16.90% 0.07% 0.65% NA
All Japonica  1512 0.80% 99.00% 0.00% 0.20% NA
Aus  269 87.00% 13.00% 0.00% 0.00% NA
Indica I  595 97.30% 2.20% 0.00% 0.50% NA
Indica II  465 94.20% 5.20% 0.00% 0.65% NA
Indica III  913 72.20% 26.90% 0.11% 0.77% NA
Indica Intermediate  786 75.80% 23.40% 0.13% 0.64% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 97.50% 0.00% 1.24% NA
VI/Aromatic  96 7.30% 90.60% 0.00% 2.08% NA
Intermediate  90 42.20% 53.30% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715682872 C -> DEL N N silent_mutation Average:58.207; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0715682872 C -> T LOC_Os07g27070.1 upstream_gene_variant ; 229.0bp to feature; MODIFIER silent_mutation Average:58.207; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0715682872 C -> T LOC_Os07g27060.1 downstream_gene_variant ; 4111.0bp to feature; MODIFIER silent_mutation Average:58.207; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N
vg0715682872 C -> T LOC_Os07g27060-LOC_Os07g27070 intergenic_region ; MODIFIER silent_mutation Average:58.207; most accessible tissue: Zhenshan97 young leaf, score: 80.589 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715682872 NA 6.76E-06 mr1043 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.48E-42 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.02E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.93E-31 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.97E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.02E-25 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 9.32E-08 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.07E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.15E-06 mr1181 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 7.97E-31 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 9.12E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.01E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 8.94E-07 mr1457 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.26E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 8.85E-18 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.35E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.82E-12 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 3.62E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 5.09E-54 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 5.71E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 5.49E-27 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.71E-38 mr1890 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 7.78E-07 1.50E-10 mr1915 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 5.24E-59 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.78E-06 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 2.18E-38 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 5.01E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.40E-07 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 3.86E-06 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 4.05E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.27E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 1.51E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715682872 NA 3.95E-07 mr1996_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251