\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715669213:

Variant ID: vg0715669213 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15669213
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.10, others allele: 0.00, population size: 186. )

Flanking Sequence (100 bp) in Reference Genome:


GGACTGTCTGAAATTTCTCAGAACTTCACTCCCTGTCTTGAATTGCTTTTTATTTCTGTCTTGAATTGCTTTTTATTTCTCTTGAGTGATTTTCAGATCA[G/T]
ACTATACGATGTGATCAGAGTATCCGATGATACAGAGACTCCGAAATTTAATGGAACTTGAGTCTCTGTGAGGATGAAGTTCTTGCCTAAAAAATTATCG

Reverse complement sequence

CGATAATTTTTTAGGCAAGAACTTCATCCTCACAGAGACTCAAGTTCCATTAAATTTCGGAGTCTCTGTATCATCGGATACTCTGATCACATCGTATAGT[C/A]
TGATCTGAAAATCACTCAAGAGAAATAAAAAGCAATTCAAGACAGAAATAAAAAGCAATTCAAGACAGGGAGTGAAGTTCTGAGAAATTTCAGACAGTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.00% 27.30% 0.15% 0.49% NA
All Indica  2759 85.50% 14.10% 0.14% 0.33% NA
All Japonica  1512 49.50% 50.30% 0.07% 0.20% NA
Aus  269 87.40% 9.70% 0.37% 2.60% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.00% 0.22% NA
Indica III  913 70.40% 29.00% 0.33% 0.22% NA
Indica Intermediate  786 85.00% 14.10% 0.13% 0.76% NA
Temperate Japonica  767 87.70% 12.30% 0.00% 0.00% NA
Tropical Japonica  504 3.60% 96.20% 0.20% 0.00% NA
Japonica Intermediate  241 23.70% 75.10% 0.00% 1.24% NA
VI/Aromatic  96 9.40% 88.50% 0.00% 2.08% NA
Intermediate  90 60.00% 36.70% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715669213 G -> DEL N N silent_mutation Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0715669213 G -> T LOC_Os07g27050.1 upstream_gene_variant ; 2636.0bp to feature; MODIFIER silent_mutation Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0715669213 G -> T LOC_Os07g27040.1 downstream_gene_variant ; 3740.0bp to feature; MODIFIER silent_mutation Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0715669213 G -> T LOC_Os07g27040-LOC_Os07g27050 intergenic_region ; MODIFIER silent_mutation Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715669213 NA 1.59E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 1.45E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 3.81E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 7.58E-12 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 6.75E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 5.13E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 4.84E-08 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 5.13E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 3.04E-19 mr1552_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 4.55E-11 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 2.82E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 2.44E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715669213 NA 2.90E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251