\
| Variant ID: vg0715669213 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15669213 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, T: 0.10, others allele: 0.00, population size: 186. )
GGACTGTCTGAAATTTCTCAGAACTTCACTCCCTGTCTTGAATTGCTTTTTATTTCTGTCTTGAATTGCTTTTTATTTCTCTTGAGTGATTTTCAGATCA[G/T]
ACTATACGATGTGATCAGAGTATCCGATGATACAGAGACTCCGAAATTTAATGGAACTTGAGTCTCTGTGAGGATGAAGTTCTTGCCTAAAAAATTATCG
CGATAATTTTTTAGGCAAGAACTTCATCCTCACAGAGACTCAAGTTCCATTAAATTTCGGAGTCTCTGTATCATCGGATACTCTGATCACATCGTATAGT[C/A]
TGATCTGAAAATCACTCAAGAGAAATAAAAAGCAATTCAAGACAGAAATAAAAAGCAATTCAAGACAGGGAGTGAAGTTCTGAGAAATTTCAGACAGTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.00% | 27.30% | 0.15% | 0.49% | NA |
| All Indica | 2759 | 85.50% | 14.10% | 0.14% | 0.33% | NA |
| All Japonica | 1512 | 49.50% | 50.30% | 0.07% | 0.20% | NA |
| Aus | 269 | 87.40% | 9.70% | 0.37% | 2.60% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 70.40% | 29.00% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 85.00% | 14.10% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 3.60% | 96.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 23.70% | 75.10% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 9.40% | 88.50% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 36.70% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715669213 | G -> DEL | N | N | silent_mutation | Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0715669213 | G -> T | LOC_Os07g27050.1 | upstream_gene_variant ; 2636.0bp to feature; MODIFIER | silent_mutation | Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0715669213 | G -> T | LOC_Os07g27040.1 | downstream_gene_variant ; 3740.0bp to feature; MODIFIER | silent_mutation | Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0715669213 | G -> T | LOC_Os07g27040-LOC_Os07g27050 | intergenic_region ; MODIFIER | silent_mutation | Average:30.878; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715669213 | NA | 1.59E-07 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 1.45E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 3.81E-07 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 7.58E-12 | mr1871 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 6.75E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 5.13E-08 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 4.84E-08 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 5.13E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 3.04E-19 | mr1552_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 4.55E-11 | mr1552_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 2.82E-08 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 2.44E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715669213 | NA | 2.90E-06 | mr1966_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |