\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715644976:

Variant ID: vg0715644976 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15644976
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATCCCCATAGGCACCTCGGAGGCTATGTCAAAACGGCATAAAGGGTTGTTAGGTGTTATCGTGATGGCGGATATATGGGCAAAACACAGGATTTGAGAA[T/C]
GCCAGAAATCCTCCGAGTAGTGGTATATATATATATATATATATATATGTATTGAACTGTAAGGGAACTTACAGATGTGGATACATTGGAGCTATACATA

Reverse complement sequence

TATGTATAGCTCCAATGTATCCACATCTGTAAGTTCCCTTACAGTTCAATACATATATATATATATATATATATATACCACTACTCGGAGGATTTCTGGC[A/G]
TTCTCAAATCCTGTGTTTTGCCCATATATCCGCCATCACGATAACACCTAACAACCCTTTATGCCGTTTTGACATAGCCTCCGAGGTGCCTATGGGGATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 40.20% 2.41% 0.17% NA
All Indica  2759 89.60% 10.00% 0.36% 0.04% NA
All Japonica  1512 7.30% 85.90% 6.61% 0.20% NA
Aus  269 24.50% 75.10% 0.37% 0.00% NA
Indica I  595 89.40% 10.10% 0.50% 0.00% NA
Indica II  465 96.80% 3.00% 0.22% 0.00% NA
Indica III  913 95.20% 4.60% 0.11% 0.11% NA
Indica Intermediate  786 79.00% 20.40% 0.64% 0.00% NA
Temperate Japonica  767 13.20% 74.40% 12.39% 0.00% NA
Tropical Japonica  504 0.40% 99.20% 0.40% 0.00% NA
Japonica Intermediate  241 2.90% 94.60% 1.24% 1.24% NA
VI/Aromatic  96 5.20% 92.70% 0.00% 2.08% NA
Intermediate  90 56.70% 37.80% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715644976 T -> DEL N N silent_mutation Average:57.313; most accessible tissue: Callus, score: 83.188 N N N N
vg0715644976 T -> C LOC_Os07g27010.1 intron_variant ; MODIFIER silent_mutation Average:57.313; most accessible tissue: Callus, score: 83.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715644976 NA 3.66E-52 mr1068 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 1.34E-21 mr1131 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 4.45E-26 mr1181 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 6.73E-06 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 5.50E-11 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 1.15E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 1.45E-10 mr1379 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 7.97E-28 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 4.45E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 5.76E-11 mr1524 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 1.96E-42 mr1526 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 3.42E-25 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 4.54E-08 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 7.75E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 4.27E-11 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 4.65E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 8.14E-06 mr1519_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 3.51E-32 mr1580_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 9.57E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 2.48E-09 mr1721_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 2.34E-33 mr1825_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 3.93E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 2.31E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715644976 NA 2.25E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251