\
| Variant ID: vg0715576538 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15576538 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.21, others allele: 0.00, population size: 259. )
GGAAAGCAAACCCGAATAAACGGAGTGGGTTTCGATTCAACTCAAGTATCCCAAGGGTCCAAGGAAGGATTGCGACAAATGGCAAGGGTTTCGGGACTTC[A/G]
ATTAGCTTAGCACCGAAATGCTTAACGAAACGGACGGAGAGGGGAGAGGTCAAGGAAGGGACATTACCCTAGGTGGCGATTCTGTAAAAACTACTGGGTT
AACCCAGTAGTTTTTACAGAATCGCCACCTAGGGTAATGTCCCTTCCTTGACCTCTCCCCTCTCCGTCCGTTTCGTTAAGCATTTCGGTGCTAAGCTAAT[T/C]
GAAGTCCCGAAACCCTTGCCATTTGTCGCAATCCTTCCTTGGACCCTTGGGATACTTGAGTTGAATCGAAACCCACTCCGTTTATTCGGGTTTGCTTTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 27.50% | 0.23% | 0.02% | NA |
| All Indica | 2759 | 80.60% | 19.10% | 0.29% | 0.04% | NA |
| All Japonica | 1512 | 61.00% | 38.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 37.50% | 62.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.40% | 11.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 95.10% | 4.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.50% | 28.00% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 76.70% | 22.90% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 31.70% | 68.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.40% | 2.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.00% | 22.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 20.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715576538 | A -> DEL | N | N | silent_mutation | Average:53.607; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0715576538 | A -> G | LOC_Os07g26900.1 | upstream_gene_variant ; 3415.0bp to feature; MODIFIER | silent_mutation | Average:53.607; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0715576538 | A -> G | LOC_Os07g26890.1 | downstream_gene_variant ; 4528.0bp to feature; MODIFIER | silent_mutation | Average:53.607; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| vg0715576538 | A -> G | LOC_Os07g26890-LOC_Os07g26900 | intergenic_region ; MODIFIER | silent_mutation | Average:53.607; most accessible tissue: Minghui63 panicle, score: 70.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715576538 | NA | 8.31E-12 | mr1229 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 1.11E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 4.11E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 7.84E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 1.04E-08 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 2.46E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 7.14E-06 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715576538 | NA | 2.80E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |