\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0715539794:

Variant ID: vg0715539794 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 15539794
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGAAGCATACATCGTGGAAATTTGCCCAAGGTGTGTCGCTTGGAATTCTGTTGGTTTCAAGCTTCTCCGATGGTGTGTTTTTTCTTTTTTAATAAC[G/A]
GAATAGAATATCTCGGTTTTTGCGTAACGAGCTATAACTATTAATTACAGAGTAGTGCACAATAAAAACTTTATCACACCAAAAAGAAAAGACACCCGTG

Reverse complement sequence

CACGGGTGTCTTTTCTTTTTGGTGTGATAAAGTTTTTATTGTGCACTACTCTGTAATTAATAGTTATAGCTCGTTACGCAAAAACCGAGATATTCTATTC[C/T]
GTTATTAAAAAAGAAAAAACACACCATCGGAGAAGCTTGAAACCAACAGAATTCCAAGCGACACACCTTGGGCAAATTTCCACGATGTATGCTTCCTCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.10% 7.80% 16.55% 5.59% NA
All Indica  2759 80.50% 12.50% 6.92% 0.00% NA
All Japonica  1512 50.80% 0.60% 33.27% 15.34% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 90.10% 1.00% 8.91% 0.00% NA
Indica II  465 35.90% 48.40% 15.70% 0.00% NA
Indica III  913 95.80% 2.60% 1.53% 0.00% NA
Indica Intermediate  786 81.90% 11.60% 6.49% 0.00% NA
Temperate Japonica  767 75.20% 0.70% 16.69% 7.43% NA
Tropical Japonica  504 22.80% 0.40% 54.56% 22.22% NA
Japonica Intermediate  241 31.50% 0.80% 41.49% 26.14% NA
VI/Aromatic  96 10.40% 0.00% 64.58% 25.00% NA
Intermediate  90 53.30% 13.30% 24.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0715539794 G -> DEL N N silent_mutation Average:59.833; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0715539794 G -> A LOC_Os07g26860.1 upstream_gene_variant ; 2909.0bp to feature; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N
vg0715539794 G -> A LOC_Os07g26850-LOC_Os07g26860 intergenic_region ; MODIFIER silent_mutation Average:59.833; most accessible tissue: Minghui63 flag leaf, score: 72.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0715539794 4.12E-11 2.42E-10 mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 7.90E-07 2.07E-07 mr1309 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 4.96E-07 1.86E-07 mr1484 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 8.89E-08 7.68E-07 mr1841 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 1.35E-06 4.91E-07 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 1.45E-07 1.57E-08 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 3.16E-06 NA mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0715539794 NA 1.58E-06 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251