\
| Variant ID: vg0715539794 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 15539794 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGGAGGAAGCATACATCGTGGAAATTTGCCCAAGGTGTGTCGCTTGGAATTCTGTTGGTTTCAAGCTTCTCCGATGGTGTGTTTTTTCTTTTTTAATAAC[G/A]
GAATAGAATATCTCGGTTTTTGCGTAACGAGCTATAACTATTAATTACAGAGTAGTGCACAATAAAAACTTTATCACACCAAAAAGAAAAGACACCCGTG
CACGGGTGTCTTTTCTTTTTGGTGTGATAAAGTTTTTATTGTGCACTACTCTGTAATTAATAGTTATAGCTCGTTACGCAAAAACCGAGATATTCTATTC[C/T]
GTTATTAAAAAAGAAAAAACACACCATCGGAGAAGCTTGAAACCAACAGAATTCCAAGCGACACACCTTGGGCAAATTTCCACGATGTATGCTTCCTCCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.10% | 7.80% | 16.55% | 5.59% | NA |
| All Indica | 2759 | 80.50% | 12.50% | 6.92% | 0.00% | NA |
| All Japonica | 1512 | 50.80% | 0.60% | 33.27% | 15.34% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 90.10% | 1.00% | 8.91% | 0.00% | NA |
| Indica II | 465 | 35.90% | 48.40% | 15.70% | 0.00% | NA |
| Indica III | 913 | 95.80% | 2.60% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 81.90% | 11.60% | 6.49% | 0.00% | NA |
| Temperate Japonica | 767 | 75.20% | 0.70% | 16.69% | 7.43% | NA |
| Tropical Japonica | 504 | 22.80% | 0.40% | 54.56% | 22.22% | NA |
| Japonica Intermediate | 241 | 31.50% | 0.80% | 41.49% | 26.14% | NA |
| VI/Aromatic | 96 | 10.40% | 0.00% | 64.58% | 25.00% | NA |
| Intermediate | 90 | 53.30% | 13.30% | 24.44% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0715539794 | G -> DEL | N | N | silent_mutation | Average:59.833; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg0715539794 | G -> A | LOC_Os07g26860.1 | upstream_gene_variant ; 2909.0bp to feature; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| vg0715539794 | G -> A | LOC_Os07g26850-LOC_Os07g26860 | intergenic_region ; MODIFIER | silent_mutation | Average:59.833; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0715539794 | 4.12E-11 | 2.42E-10 | mr1238 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | 7.90E-07 | 2.07E-07 | mr1309 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | 4.96E-07 | 1.86E-07 | mr1484 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | 8.89E-08 | 7.68E-07 | mr1841 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | 1.35E-06 | 4.91E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | 1.45E-07 | 1.57E-08 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | 3.16E-06 | NA | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0715539794 | NA | 1.58E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |